ID: 1080676871

View in Genome Browser
Species Human (GRCh38)
Location 11:34435961-34435983
Sequence GCAATTATTCATATTAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676866_1080676871 -8 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data
1080676862_1080676871 18 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data
1080676864_1080676871 11 Left 1080676864 11:34435927-34435949 CCAGAGGACATCTGGGTTGCCTC No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data
1080676860_1080676871 24 Left 1080676860 11:34435914-34435936 CCATCACCAGACACCAGAGGACA No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676871 Original CRISPR GCAATTATTCATATTAAAGC GGG Intergenic
No off target data available for this crispr