ID: 1080676872

View in Genome Browser
Species Human (GRCh38)
Location 11:34435971-34435993
Sequence ATATTAAAGCGGGAAAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676868_1080676872 -4 Left 1080676868 11:34435952-34435974 CCCAAGTAGGCAATTATTCATAT No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676869_1080676872 -5 Left 1080676869 11:34435953-34435975 CCAAGTAGGCAATTATTCATATT No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676864_1080676872 21 Left 1080676864 11:34435927-34435949 CCAGAGGACATCTGGGTTGCCTC No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676867_1080676872 -1 Left 1080676867 11:34435949-34435971 CCTCCCAAGTAGGCAATTATTCA No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676866_1080676872 2 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676862_1080676872 28 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676872 Original CRISPR ATATTAAAGCGGGAAAGATA TGG Intergenic
No off target data available for this crispr