ID: 1080676874

View in Genome Browser
Species Human (GRCh38)
Location 11:34435997-34436019
Sequence AGCCAAATAGGCAGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676868_1080676874 22 Left 1080676868 11:34435952-34435974 CCCAAGTAGGCAATTATTCATAT No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data
1080676867_1080676874 25 Left 1080676867 11:34435949-34435971 CCTCCCAAGTAGGCAATTATTCA No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data
1080676869_1080676874 21 Left 1080676869 11:34435953-34435975 CCAAGTAGGCAATTATTCATATT No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data
1080676866_1080676874 28 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676874 Original CRISPR AGCCAAATAGGCAGAGCAGA AGG Intergenic
No off target data available for this crispr