ID: 1080678564

View in Genome Browser
Species Human (GRCh38)
Location 11:34451071-34451093
Sequence GTGGAGAACCGAACTGCGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080678564_1080678567 -9 Left 1080678564 11:34451071-34451093 CCCATCGCAGTTCGGTTCTCCAC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1080678567 11:34451085-34451107 GTTCTCCACTGTTGGTAAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 109
1080678564_1080678569 -1 Left 1080678564 11:34451071-34451093 CCCATCGCAGTTCGGTTCTCCAC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1080678569 11:34451093-34451115 CTGTTGGTAAGTTGGTTTATTGG 0: 1
1: 0
2: 0
3: 10
4: 158
1080678564_1080678571 13 Left 1080678564 11:34451071-34451093 CCCATCGCAGTTCGGTTCTCCAC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1080678571 11:34451107-34451129 GTTTATTGGCGTGATTGGTATGG 0: 1
1: 0
2: 2
3: 2
4: 43
1080678564_1080678570 8 Left 1080678564 11:34451071-34451093 CCCATCGCAGTTCGGTTCTCCAC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1080678570 11:34451102-34451124 AGTTGGTTTATTGGCGTGATTGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080678564 Original CRISPR GTGGAGAACCGAACTGCGAT GGG (reversed) Exonic
904688101 1:32274950-32274972 AGGGAGAACCGAGCTGGGATCGG - Intronic
1068855746 10:61795597-61795619 GAGGAGACCTGAACTGCCATCGG - Intergenic
1068867039 10:61904862-61904884 GTGGAAAACCGATCTGCATTGGG - Intronic
1075576257 10:123579883-123579905 GGGGAGAACTGGACTGCAATGGG + Intergenic
1079074912 11:17378650-17378672 GTGGAGACCCCAACTGCTGTTGG - Intergenic
1080678564 11:34451071-34451093 GTGGAGAACCGAACTGCGATGGG - Exonic
1094326931 12:29250911-29250933 TTGGAAAACCTAACTGCAATGGG + Intronic
1108108717 13:47043825-47043847 GTGGAGAATCGACCTGAGAAGGG - Intergenic
1110414655 13:75238609-75238631 GAGGAGAACCAAGCTGTGATAGG - Intergenic
1111595981 13:90411143-90411165 GTGAAGAAACTAACTGAGATGGG + Intergenic
1123998092 15:25733058-25733080 TTGGAGAACAGAACTGAGTTTGG - Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1133354947 16:5129292-5129314 GTGCAGCATCGAACTGGGATCGG + Intergenic
1143066683 17:4254827-4254849 GTGAAGAACTTAACTGCCATAGG - Intronic
927241876 2:20926333-20926355 GTGGAGAACAGGATTGTGATGGG + Intergenic
931520819 2:63095281-63095303 GCTGAGAACCAAACTGAGATAGG + Intergenic
931782997 2:65595975-65595997 GTGGAAAACTGAACTGATATTGG - Intergenic
941615542 2:167714325-167714347 GAGGAGAACCAAGCTGTGATAGG - Intergenic
1172508202 20:35479773-35479795 GGTGAGAACCCAACTGGGATGGG + Exonic
1178314843 21:31559149-31559171 GTGGGAAACCGAGCTCCGATTGG + Intronic
968577988 4:1376816-1376838 GTGGAGAACCGTCCTGCGGCAGG - Intronic
978095049 4:104766051-104766073 GTGGAGAACAGAGCTGTGACTGG - Intergenic
990002758 5:50913775-50913797 ATGGAAAACCGAACTGGGATTGG + Intergenic
1007278499 6:40693014-40693036 GTGGTGAACTGAACTGAGATGGG - Intergenic
1021539721 7:21743832-21743854 GTGGAGAACTGAGCTGCAAAAGG - Intronic
1028220408 7:88190079-88190101 GTGCAGAACTGAACTGAGGTTGG + Intronic
1028422488 7:90649141-90649163 GTGGAGAACTGAAATGCAGTAGG + Intronic
1033994089 7:147323841-147323863 GTGGAGAACAGAAATATGATTGG - Intronic
1038960996 8:32519888-32519910 GTGGATAAGCAAACTGCAATTGG + Intronic
1045985449 8:108245015-108245037 GTGGAGGGCCCAACTGAGATTGG - Intronic
1047554413 8:125913682-125913704 GTGGAGAACCAAAATGATATGGG + Intergenic
1048009333 8:130443525-130443547 GTGGGAAAGCGAACTGCGACCGG + Exonic
1199341382 X:146680998-146681020 GATGATAACCTAACTGCGATGGG - Intergenic