ID: 1080680156

View in Genome Browser
Species Human (GRCh38)
Location 11:34468216-34468238
Sequence TTGTAGTAGGTGAATTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080680156 Original CRISPR TTGTAGTAGGTGAATTTTGT TGG Intronic
901281864 1:8043637-8043659 TTTTAGTAGGTTGAGTTTGTGGG - Intergenic
901779371 1:11583306-11583328 TTTTAATATGTGAATTTTGGGGG - Intergenic
902607816 1:17578720-17578742 TTGAGGTAGGTGTTTTTTGTGGG - Intronic
905364330 1:37440810-37440832 TTGAAGGAGGTGAATTGTATTGG - Intergenic
906201749 1:43964951-43964973 AAGTAGTATGTGAATTGTGTTGG + Intronic
907068636 1:51513171-51513193 TTCTAGTAGGTGTAATTTTTGGG - Intronic
913050046 1:115109603-115109625 TTTCAGTATGTGAATTTTGAGGG + Intergenic
913368977 1:118075584-118075606 GTGTGGGAGGTGGATTTTGTGGG + Intronic
913431743 1:118802699-118802721 TTGTTGTAGGTGTATTTTGGGGG - Intergenic
921812973 1:219535537-219535559 TAGTGGCTGGTGAATTTTGTGGG - Intergenic
924420695 1:243906769-243906791 TTGTAATAGGTGAATTTTTGAGG - Intergenic
1063857294 10:10269260-10269282 TTATAGTATATGAATTTTGCGGG + Intergenic
1064743351 10:18455476-18455498 TTGTTGGAGGTTAATTCTGTTGG + Intronic
1067424642 10:46196947-46196969 TTGTAGGACTTGAATTTTTTAGG - Intergenic
1068636622 10:59355261-59355283 TTGTTGAAGGCCAATTTTGTGGG - Intronic
1070861086 10:79662866-79662888 TTGTAGGACTTGAATTTTTTAGG - Intergenic
1070876171 10:79812728-79812750 TTGTAGGACTTGAATTTTTTAGG + Intergenic
1071643101 10:87334860-87334882 TTGTAGGACTTGAATTTTTTAGG + Intergenic
1073718193 10:106133550-106133572 TTGCAGTGAGTGAATTTTGAAGG + Intergenic
1079485416 11:20931290-20931312 TTCTAGAAGTTGACTTTTGTGGG + Intronic
1079567587 11:21901758-21901780 TTATAGCAGGTGATTTTTTTTGG - Intergenic
1080680156 11:34468216-34468238 TTGTAGTAGGTGAATTTTGTTGG + Intronic
1081121698 11:39274163-39274185 TTTTAGCATGTGAATTTTGAGGG + Intergenic
1082886886 11:58094444-58094466 TTGTTGTAGATGTATTTTGAGGG - Intronic
1083136781 11:60685998-60686020 TTGTAGCAGGATAATTTTGAGGG + Intergenic
1085104217 11:73828013-73828035 TTGTTGTAGGTGAATTTTTCCGG + Intronic
1085163392 11:74370884-74370906 TTGTAGTAAGTGTGTTGTGTTGG - Exonic
1085704245 11:78771633-78771655 TTGTAGTAGGTCAATTTTATTGG + Intronic
1086107527 11:83161947-83161969 ATGTTTTAGGTGAATGTTGTTGG + Intronic
1086313732 11:85566712-85566734 TTTTAAAATGTGAATTTTGTGGG + Intronic
1086563758 11:88200044-88200066 TTGTTGAAGGTGATTTTAGTTGG - Intergenic
1087307122 11:96500841-96500863 TTGCAGGAGGTGGAATTTGTGGG - Intronic
1091521690 12:1251434-1251456 TTGTCGTAGGTGAGTTTTTATGG + Intronic
1091927506 12:4367577-4367599 CTGTAGCAGGTGACCTTTGTAGG + Intergenic
1092983436 12:13820841-13820863 GTGTAGAGGGTGGATTTTGTGGG - Intronic
1093119252 12:15247888-15247910 TTGTAGTATTTGAATATTCTGGG - Intronic
1093871933 12:24303172-24303194 TATTTGTAGGTGAATTTTCTTGG + Intergenic
1098390293 12:69962720-69962742 TTGTTGTAAGTGAATTTTTATGG - Intergenic
1100360090 12:93869735-93869757 CTTTAGTTGGTGATTTTTGTTGG - Intronic
1100582675 12:95949980-95950002 GTGCAGGAGGTGAATTTTGAGGG - Intronic
1100818306 12:98407135-98407157 TTGTAAGAGATGAATTTTTTTGG - Intergenic
1101132841 12:101707058-101707080 TTGTAGAAGGTGTATTTTTAAGG + Intronic
1101440384 12:104700179-104700201 TTGTAGTACTGGAATTTAGTTGG - Intronic
1101885898 12:108661697-108661719 TGGTAGAAGGTGTACTTTGTTGG - Intronic
1102348769 12:112176605-112176627 TTTTGGTAGGTGACTTTTCTGGG + Exonic
1103076376 12:117986176-117986198 TTTTAATATATGAATTTTGTGGG - Intergenic
1103200508 12:119084191-119084213 CTGTAGAAGGTGAATATTGGAGG + Intronic
1104908882 12:132230120-132230142 TGGTGGTATGTGAATTTTGGTGG - Intronic
1107699233 13:43031349-43031371 TTGTAGGCAGTTAATTTTGTAGG + Intronic
1108289754 13:48947431-48947453 TAGTTGTAAGGGAATTTTGTGGG - Intergenic
1108409943 13:50135257-50135279 TTGTAGTTAGAGAATTGTGTTGG + Intronic
1110454187 13:75671673-75671695 TTGTAAGACGTGAATGTTGTTGG - Intronic
1110878796 13:80544327-80544349 AAGAAGTAGGTAAATTTTGTTGG + Intergenic
1112612850 13:100973029-100973051 TTGGAGTAGATGAATTTGCTGGG + Intergenic
1114965282 14:27951826-27951848 TTGTAGTGGGTCATTGTTGTTGG - Intergenic
1116244358 14:42390148-42390170 TTCTAGTAAGTGAATTATTTAGG + Intergenic
1118998257 14:70857380-70857402 TTGCAGTATGTGAGTTTTGTAGG - Intergenic
1120565963 14:86057318-86057340 ATGTATTAGGTTTATTTTGTTGG + Intergenic
1122173203 14:99894279-99894301 TTGTGTTAGTTGAATTTTGGGGG + Intronic
1124344679 15:28914305-28914327 TGGTATTAGGTGACTTTTGAAGG + Intronic
1124410981 15:29436599-29436621 TAGAAGTAGATGATTTTTGTAGG - Intronic
1125124882 15:36208520-36208542 TTCTAGAAGGTGCATTTTGCAGG + Intergenic
1125365165 15:38905595-38905617 TTTTAATATATGAATTTTGTGGG + Intergenic
1125754520 15:42053969-42053991 TTGTAGGAGGTGAATTTTACAGG - Intergenic
1127465737 15:59242707-59242729 TTTTAGGATGTGTATTTTGTGGG - Intronic
1128000852 15:64190318-64190340 TTGTAGTAGGGGAATATTTTGGG - Intronic
1130089449 15:80807821-80807843 TTGTAGTAGGGGTAGTTTATAGG + Intronic
1130640366 15:85667767-85667789 TTGGAGTAGGTGAGTTTTCAAGG + Intronic
1132083567 15:98887739-98887761 TTATACGACGTGAATTTTGTGGG + Intronic
1133395691 16:5445460-5445482 ATATAGTAGGTGATATTTGTTGG + Intergenic
1135872401 16:26162923-26162945 TTTTAGTACATGAATTTTGGGGG + Intergenic
1138853185 16:60655113-60655135 TTGCAGAAGCTGCATTTTGTAGG + Intergenic
1140076271 16:71701482-71701504 TTGTAGTACTTAAATTTTGAGGG - Intronic
1140725660 16:77809285-77809307 TTGTAATAGGTAACTTTTATGGG - Intronic
1141911707 16:87064622-87064644 TTTTATTAGGTAAATTTAGTAGG + Intergenic
1146235954 17:31162472-31162494 TTGTAATCGGTGAACTTTTTTGG + Intronic
1146677880 17:34785951-34785973 TTGCAGGAGGTGAATGTGGTGGG - Intergenic
1147643812 17:42021663-42021685 ATGTAGTGGGTGAGTGTTGTTGG + Exonic
1150927524 17:69548971-69548993 TTGTAGTAGGGAATTTTTGTTGG + Intergenic
1153122528 18:1746669-1746691 TTATTGTGGGTGAATTTTATAGG + Intergenic
1155662507 18:28267012-28267034 TTATATTAAGTGAATTTAGTAGG + Intergenic
1156593234 18:38516013-38516035 TTGTAGTAGGTTATTTTTAGCGG - Intergenic
1158643432 18:59221487-59221509 TTGTTGTAGTTGGCTTTTGTGGG - Intronic
1158751035 18:60261326-60261348 TTTTAATAGGTGAAGTATGTTGG + Intergenic
927394067 2:22629272-22629294 TTGGAGGATGTGAATTTTGGTGG - Intergenic
930740590 2:54828590-54828612 ATGTTGCAGGTGAATTTTCTTGG + Intronic
931758078 2:65391891-65391913 TTGCATTAGTTGAAATTTGTAGG + Intronic
931811036 2:65855353-65855375 CTGTAGAAGGAAAATTTTGTGGG - Intergenic
932321366 2:70824233-70824255 TTGTTGTTGCTGTATTTTGTAGG - Intergenic
933479449 2:82837199-82837221 TTGTAGTAAGTGACTTAAGTAGG + Intergenic
935798484 2:106668819-106668841 TTGAATGAGTTGAATTTTGTAGG - Intergenic
939042750 2:137210602-137210624 TTTGAGTGGGAGAATTTTGTAGG + Intronic
940202120 2:151163447-151163469 GTATAGTAGGTGATTTTTGGAGG - Intergenic
941557169 2:166995762-166995784 TTGTAGTAGGTGGAGATTATAGG + Intronic
941709670 2:168698702-168698724 TTTTCGTAGGTGAATTATTTTGG + Intronic
941864414 2:170319188-170319210 TTGTAGTATTTGCATTTTCTAGG + Intronic
943742953 2:191430909-191430931 TTTCAGTAGGTGAATTTAGACGG - Intergenic
943828600 2:192428803-192428825 TTGTAGTATTTGATTTGTGTTGG - Intergenic
944380525 2:199104414-199104436 TAGAAGTTGGTCAATTTTGTTGG + Intergenic
944759051 2:202794177-202794199 TAATAGTTGTTGAATTTTGTTGG - Intronic
944782744 2:203036722-203036744 TTATAGTTGCTCAATTTTGTAGG + Intronic
945212490 2:207397927-207397949 CTTTAGTTGGTGTATTTTGTAGG - Intergenic
945878350 2:215301771-215301793 TTGTATTAGGTGGATATTGTGGG - Intergenic
946427005 2:219604506-219604528 TGGTAGTGGATGAATTTTGCTGG + Intronic
946695556 2:222354833-222354855 TTTTAGCATATGAATTTTGTGGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948469956 2:238171011-238171033 GTGTTGTAGGTTCATTTTGTTGG - Exonic
948705172 2:239786630-239786652 TTGTAGTTATTGAATTTTGTTGG - Intronic
1169645021 20:7800969-7800991 TTTCAGCATGTGAATTTTGTGGG - Intergenic
1169872238 20:10260191-10260213 TTAAAGTAGGTGAAGTTCGTAGG + Intronic
1170304002 20:14917603-14917625 TTGTAGTCGGTGTGTTTTGGAGG - Intronic
1173452560 20:43178057-43178079 TTGTAGTATCTGGATTTGGTTGG + Intronic
1177009009 21:15708852-15708874 TTGATGTAGGTCAATTTTATAGG + Intergenic
1178642320 21:34355058-34355080 TTGTATTATCTGAATTGTGTGGG - Intergenic
1178997960 21:37423945-37423967 TTTTAAAATGTGAATTTTGTAGG + Intronic
1179480700 21:41676144-41676166 TTAAAATAGGTGGATTTTGTTGG - Intergenic
1180661259 22:17469295-17469317 TTCTAGTATTTGAATTTTGGGGG + Intronic
949691555 3:6646218-6646240 TTGTAATAGGAGAAAATTGTTGG - Intergenic
950186250 3:10947486-10947508 TTGGAGGAGGTGAATTCAGTTGG - Intergenic
952438898 3:33302837-33302859 TTTTAGTAGTTGAATTTGCTTGG + Intronic
953161322 3:40422843-40422865 TTTTGGTAGGAGAATTCTGTAGG - Exonic
953595381 3:44307741-44307763 TTTTACTTCGTGAATTTTGTAGG - Intronic
953657983 3:44869056-44869078 TTAAAGTGGGTGAATTTTATTGG + Intronic
953868554 3:46606025-46606047 TTGTAGTAGTTGAGTTTTGGGGG - Intronic
956095452 3:65711530-65711552 TTTTAGCAGATGAATTTTGGGGG - Intronic
958461221 3:94398941-94398963 TTGTAGTAGTTGAAGATTATAGG - Intergenic
962288091 3:134105445-134105467 TTTTAACATGTGAATTTTGTGGG + Intronic
962292531 3:134148519-134148541 TTGTGGGAGGTGGGTTTTGTAGG + Intronic
963087470 3:141451665-141451687 TTGTAGTATGGGACTTTAGTTGG - Intergenic
963846738 3:150166756-150166778 TTAAAGTGGGTGAATTTTATAGG - Intergenic
964929550 3:162000581-162000603 TTGTAGTAGGAAAATATAGTTGG - Intergenic
965272266 3:166633354-166633376 ATGCAGTATGTTAATTTTGTTGG - Intergenic
966139568 3:176740131-176740153 TTGTAGTAGGCAATTTTTTTAGG + Intergenic
967280687 3:187820507-187820529 TCCTAGTAGTTAAATTTTGTGGG + Intergenic
970127113 4:12827222-12827244 TTTTAGCAGATGAATTTTGTGGG - Intergenic
970829119 4:20314524-20314546 TTTTAGAAAGTGAATATTGTGGG + Intronic
970935524 4:21565612-21565634 TTGCTTTAGGTGAATGTTGTAGG - Intronic
974402206 4:61422279-61422301 TTGTAGTTGGTTAACTTTCTAGG - Intronic
979003893 4:115263675-115263697 ATGTAGCATGTGAATTTTGCAGG + Intergenic
979996939 4:127442655-127442677 TTTCAGCATGTGAATTTTGTGGG - Intergenic
980155125 4:129095147-129095169 TTTTAGTAGTTGAATTTTAATGG + Intronic
984653018 4:182289769-182289791 TTGTAGAAGTTGAATTTAATGGG + Intronic
985330976 4:188833599-188833621 TTGTAGTTGTTCAATTTTGTTGG - Intergenic
989708594 5:44369057-44369079 TGGTATTATGTGTATTTTGTAGG + Intronic
990548900 5:56852380-56852402 TTTTAACAGGTGAGTTTTGTAGG + Intronic
991190074 5:63860722-63860744 TTGTCTTATTTGAATTTTGTTGG + Intergenic
991274376 5:64826824-64826846 TTTTAGTTGGTAAATTTTCTTGG + Intronic
993640993 5:90405277-90405299 TTCTGGTATGTGATTTTTGTTGG - Intronic
994522467 5:100857774-100857796 TTGTTGTAGCTAAATATTGTCGG - Intronic
994949571 5:106442253-106442275 TTGTACAAGGTTAACTTTGTAGG + Intergenic
995159999 5:108968082-108968104 TTTTAGCAGGTAATTTTTGTTGG - Intronic
995194534 5:109349101-109349123 TAGTAATAGCTGTATTTTGTTGG + Intronic
995774953 5:115715137-115715159 TTCTAGTTGGTGAAGTTTGATGG - Intergenic
995999382 5:118340730-118340752 TTTTAATACGTGAATTTTGTGGG - Intergenic
998732432 5:145095305-145095327 TTGTATTAAGTGAATTGTCTTGG - Intergenic
999996107 5:157094011-157094033 TTGAAGTTGATGAATTTTGATGG - Intronic
1001149128 5:169211493-169211515 TGGTAGGAGGTGAATTTTGAGGG - Intronic
1001647311 5:173291705-173291727 TTTCAATAGGTGAATTGTGTGGG - Intergenic
1003617283 6:7667277-7667299 TTCTAATAGGTGATTTTTCTAGG - Intergenic
1005156501 6:22812987-22813009 TTGTAGTTTTTGATTTTTGTGGG + Intergenic
1005654249 6:27916906-27916928 TTATAAAAGGTTAATTTTGTAGG + Intergenic
1008304345 6:49883572-49883594 TTGTTGAAGGTGACTTTTGTTGG + Intergenic
1008962732 6:57282375-57282397 TTTTAGTACGTAAATTCTGTTGG + Intergenic
1009821623 6:68809975-68809997 TTGGAGTAAGAGCATTTTGTGGG + Intronic
1010574758 6:77517168-77517190 TTTTAGTAGCTGAATTTTAGAGG + Intergenic
1011467647 6:87674948-87674970 TTGTAGTACTGGAATTTAGTTGG - Intergenic
1012051858 6:94356240-94356262 TTATAGTTTATGAATTTTGTAGG - Intergenic
1014044150 6:116864565-116864587 TAGTAGTAAGTGAATGTTGAAGG + Intergenic
1015294817 6:131578286-131578308 TTGTATCAGGTGAAATTTCTTGG + Intronic
1017130514 6:151104643-151104665 ATGTAGTATGTGGATTTTCTGGG - Intergenic
1017853189 6:158324097-158324119 TTCTAGTAAGTGCATTTTATCGG - Intronic
1017989390 6:159472950-159472972 CTGCAGAAAGTGAATTTTGTAGG + Intergenic
1018149607 6:160925910-160925932 TTGTAAGACGTGAATTTTGAGGG + Intergenic
1020251972 7:6476543-6476565 TACAAGTAGGTGAATTTTGTGGG + Intronic
1020726531 7:11821718-11821740 ATGCAGTAGGGTAATTTTGTAGG - Intronic
1020733238 7:11911142-11911164 TTTTAGTAGGTGAGATTTCTTGG + Intergenic
1021835007 7:24662296-24662318 TTGTGTTATTTGAATTTTGTTGG + Intronic
1022419376 7:30206272-30206294 TTGGGGTTGGTGGATTTTGTGGG + Intergenic
1025616171 7:63119314-63119336 TAGTACTAGGTGACTTTTCTGGG + Intergenic
1026237469 7:68539950-68539972 TTGTGGTAGGTAGATTTTATTGG - Intergenic
1027898142 7:84072013-84072035 TGGTAATATTTGAATTTTGTAGG - Intronic
1028655260 7:93197995-93198017 TTCAAGTATGTGAATTTTCTAGG + Intronic
1030700309 7:112631153-112631175 TTGTATTATGTTAATTTTGGGGG - Intergenic
1032599813 7:133281453-133281475 TTGTTTTTGTTGAATTTTGTTGG - Intronic
1034748825 7:153549404-153549426 TTTTTATAGGTGAATTTTGATGG + Intergenic
1038169686 8:25118062-25118084 TTGTGGTCAGAGAATTTTGTTGG - Intergenic
1039896631 8:41721064-41721086 CTGCAGCATGTGAATTTTGTGGG - Intronic
1041464267 8:58143185-58143207 TTGAAGTAGGTTTACTTTGTTGG + Intronic
1043174199 8:77003270-77003292 TGATAATAGGTAAATTTTGTTGG + Intergenic
1046003168 8:108445517-108445539 TTGTAGTAGGTGAGCTTTGTGGG - Intronic
1046584270 8:116132117-116132139 TTGGAGTATGTAGATTTTGTCGG + Intergenic
1048236779 8:132698755-132698777 TTGTGGTGTGTGATTTTTGTTGG - Intronic
1048380213 8:133859098-133859120 TTGCAGTAAGTGATTTTTCTGGG - Intergenic
1048454217 8:134563480-134563502 TTGTGGGAGGTGAATTTTCATGG - Intronic
1048469265 8:134692567-134692589 TTTGACTAGGTGAATTTTGGAGG - Intronic
1057014511 9:91639544-91639566 ATGTGATAGGTGATTTTTGTGGG + Intronic
1059841159 9:118218321-118218343 TTGTATTATGTTAATTTTATAGG + Intergenic
1186230396 X:7447426-7447448 TTGGAGTAGGTCAGTTTTGTGGG - Intergenic
1186390975 X:9158902-9158924 TTGTAGCTGGCGCATTTTGTGGG + Intronic
1186822789 X:13308403-13308425 TTTTAGTAGGTAAATTTGGAGGG - Intergenic
1188092400 X:25979087-25979109 TTGTTGTTTGTGATTTTTGTTGG - Intergenic
1189467798 X:41290639-41290661 TTGTAGAAAATAAATTTTGTAGG - Intergenic
1189481071 X:41392754-41392776 TTGTAGGAGATAAATTTTGTAGG - Intergenic
1190591016 X:52001222-52001244 TTGTAGTAGGATTATTTTATTGG + Intergenic
1192483378 X:71504191-71504213 TTGTAGGGGGTGAAATCTGTAGG - Intronic
1193813280 X:86076772-86076794 TTTTAGCAGGTGATTTTTTTCGG + Intergenic
1196053292 X:111328377-111328399 TTGTAGAAGGGAAATTCTGTAGG + Intronic
1196346650 X:114668943-114668965 TTGAAATAAGTGACTTTTGTAGG + Intronic
1197261049 X:124318511-124318533 TTCTAGTAGTTGAATTTAGCAGG - Intronic
1198188846 X:134283649-134283671 TTAAAGTGGGTGAATTTTATGGG + Intergenic
1200037591 X:153343257-153343279 CTGGAGTAGCTGGATTTTGTGGG + Intronic