ID: 1080681251

View in Genome Browser
Species Human (GRCh38)
Location 11:34478163-34478185
Sequence CTGCGTGTCCAGAAGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080681246_1080681251 22 Left 1080681246 11:34478118-34478140 CCACCATCAATAGTGCAAGAACA No data
Right 1080681251 11:34478163-34478185 CTGCGTGTCCAGAAGGCAGTAGG No data
1080681247_1080681251 19 Left 1080681247 11:34478121-34478143 CCATCAATAGTGCAAGAACAAAG No data
Right 1080681251 11:34478163-34478185 CTGCGTGTCCAGAAGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080681251 Original CRISPR CTGCGTGTCCAGAAGGCAGT AGG Intergenic
No off target data available for this crispr