ID: 1080682180

View in Genome Browser
Species Human (GRCh38)
Location 11:34487221-34487243
Sequence CTCTGGGGCTGGCTCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080682170_1080682180 13 Left 1080682170 11:34487185-34487207 CCTGGCCAGGGCATTGAGGCTGG 0: 1
1: 0
2: 1
3: 100
4: 446
Right 1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG 0: 1
1: 1
2: 3
3: 49
4: 361
1080682172_1080682180 8 Left 1080682172 11:34487190-34487212 CCAGGGCATTGAGGCTGGAATAA 0: 1
1: 0
2: 1
3: 27
4: 634
Right 1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG 0: 1
1: 1
2: 3
3: 49
4: 361
1080682168_1080682180 22 Left 1080682168 11:34487176-34487198 CCATGGTGTCCTGGCCAGGGCAT 0: 1
1: 1
2: 1
3: 19
4: 229
Right 1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG 0: 1
1: 1
2: 3
3: 49
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080682180 Original CRISPR CTCTGGGGCTGGCTCTCAGG TGG Intronic
900209080 1:1444662-1444684 CCCTGGGGCTGGGTCACTGGGGG + Intergenic
900218915 1:1496580-1496602 CCCTGGGGCTGGGTCACTGGGGG + Intronic
900377102 1:2359954-2359976 CTTTGGGACGGGCTCTCAAGTGG + Intronic
900693483 1:3995714-3995736 CCCTGAGGCTGGCTCAGAGGAGG + Intergenic
901688151 1:10955910-10955932 CACTGTGTCAGGCTCTCAGGGGG + Intronic
902414644 1:16231589-16231611 CTCTGGGGCTGGGTCTCTGCAGG + Intergenic
902564785 1:17304357-17304379 CTCTGGGACAGGAGCTCAGGTGG + Intergenic
902655723 1:17866624-17866646 CTCTGGAGCAGGCTCTCTGGAGG - Intergenic
903129578 1:21270014-21270036 TTCTGGGGCTGGTTCTCACTGGG - Intronic
903289249 1:22297419-22297441 ACCTGGGCCTGGCACTCAGGGGG + Intergenic
904287242 1:29460584-29460606 CCCTTGGGCTGGGTGTCAGGTGG - Intergenic
905284955 1:36873191-36873213 CACAGGGCCTGGCACTCAGGTGG + Intronic
905792495 1:40797714-40797736 CTCTGGAGGAGGCACTCAGGAGG - Intronic
906210163 1:44008366-44008388 CGCTGGGGCTGGTCCTCTGGAGG + Exonic
907554756 1:55334290-55334312 CCCTAGGGCTGGGTCTGAGGAGG + Intergenic
908782294 1:67701404-67701426 CTCAGCAGCTTGCTCTCAGGAGG + Intergenic
909974526 1:82029747-82029769 TTCTGGGGCTGGGTGGCAGGGGG - Intergenic
912389318 1:109291129-109291151 CCATGGTGCTGGCTCTCAGTGGG + Intergenic
912631167 1:111247891-111247913 CTCTGTGGCTGGCACTGAGCGGG - Intergenic
912798310 1:112706044-112706066 CTCTGGGGCTGCCTCTCACAGGG - Exonic
913052477 1:115129675-115129697 ATGTGGAGCTGACTCTCAGGAGG - Intergenic
913259729 1:116987366-116987388 CGCGGAAGCTGGCTCTCAGGCGG - Exonic
913479757 1:119276700-119276722 CTGTAGGGCAGGCACTCAGGAGG + Intergenic
913509408 1:119548344-119548366 CTCAGAGCCTGGCTCTCAGGTGG - Intergenic
915282167 1:154829952-154829974 CTCTGGGGTTGACACTCTGGTGG - Intronic
915524727 1:156468564-156468586 CCCTGGGGCTGGCTCTCAGAAGG + Intronic
915596146 1:156897571-156897593 CCCTGAGGCTGGCTCCCAGCTGG - Intronic
915822992 1:159045396-159045418 GTGTGGGGATGGCTCTCAGCTGG - Exonic
915823352 1:159049531-159049553 GTGTGGGGATGGCTCTCAGCTGG - Intronic
918324242 1:183394639-183394661 ATCTGGGGCTGACAGTCAGGTGG - Intronic
919943615 1:202304756-202304778 TTCTGGGGTAGGCTCTCAGCAGG - Intronic
920165602 1:204033495-204033517 ATCTGAGGCTGGAACTCAGGAGG - Intergenic
920505200 1:206510788-206510810 CTCTGGGCCTGGCACTCTGCTGG - Intronic
920541027 1:206778085-206778107 GGCTGGGGCTGGCCCTTAGGTGG + Intergenic
920704919 1:208243899-208243921 CGCTGTCGCCGGCTCTCAGGGGG + Exonic
922746873 1:228049102-228049124 CACTGGGGCTGGCCCTGGGGAGG + Intronic
924708854 1:246518460-246518482 CTGTGGGGCAGACTCCCAGGAGG + Intergenic
1062768211 10:81068-81090 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1062997454 10:1880490-1880512 CTCTGGGTCTTGTTCTCAGGAGG + Intergenic
1063349577 10:5341824-5341846 CTCTGGGGCTAGTTTTGAGGGGG - Intergenic
1063923187 10:10951662-10951684 CTCAAGGGCTGGCTCTGATGGGG - Intergenic
1064271555 10:13870622-13870644 CTGTGGACCTGCCTCTCAGGAGG - Intronic
1065801465 10:29356697-29356719 CCCTGGGTCTGGCTCCCAAGGGG + Intergenic
1065977555 10:30855957-30855979 CTCTGTGCCTGGCACACAGGAGG + Intronic
1068271489 10:54732271-54732293 CTCTGGCTCTGGCTCTCTGGAGG - Intronic
1068398154 10:56491282-56491304 GTCTGTGGCAGGCTCTCAGATGG - Intergenic
1069720750 10:70547939-70547961 GGCTGGGGCTGGCTCCCAGATGG + Intronic
1069907753 10:71741847-71741869 CTCTGGCGCTCGCGGTCAGGCGG - Intronic
1070204183 10:74239588-74239610 CTCTGGTACTAGCTATCAGGAGG + Intronic
1070491677 10:76982418-76982440 CACAGGGCCTGGCACTCAGGGGG + Intronic
1070683829 10:78467535-78467557 CTCTGTGACTGGTTCACAGGTGG - Intergenic
1072591592 10:96832625-96832647 CCCCGGGGCTGGCTCTCGGCGGG + Intronic
1072739122 10:97899155-97899177 ATCTGGGACTGGCACTCAGCTGG - Intronic
1072741289 10:97911542-97911564 TGCTGGGGCTGGCACCCAGGAGG - Intronic
1073102589 10:101014430-101014452 CTCTGGGTCTGTCTCTTTGGAGG - Intronic
1073290763 10:102412143-102412165 CTCTGGACCAAGCTCTCAGGTGG - Exonic
1075078352 10:119366604-119366626 CTTTGGGGCTGGCTATCAACTGG - Intronic
1075689153 10:124384163-124384185 CTGTTGGGCTAGCTCTCCGGTGG + Intergenic
1077325457 11:1962058-1962080 CTCTTGGGCTGGCCCCCAGGCGG + Intronic
1077364852 11:2157511-2157533 CTGTGGGCCTGGCTCACATGGGG + Intronic
1078266325 11:9758450-9758472 CGTCAGGGCTGGCTCTCAGGAGG - Intergenic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1081566712 11:44265012-44265034 GTCTGGGGCTGGCAGTCACGTGG - Exonic
1081578138 11:44332455-44332477 CTATGGGGCTGGCTCTGTGCTGG - Intergenic
1083473792 11:62902387-62902409 CTCCTGGGCTGGCTCTCTGCGGG + Intergenic
1083900448 11:65640896-65640918 CTGTGGGCCTGACTCTCCGGGGG - Exonic
1084062881 11:66687395-66687417 CTCTGGAGCCTGCTCTCAGAGGG - Intronic
1084363552 11:68684193-68684215 CTCTGGGGCTGGGACCCCGGGGG + Intronic
1084589032 11:70079455-70079477 CTCTGGGTCTGGCCCTGGGGAGG - Intronic
1084669725 11:70597930-70597952 CTCAGGGGTTGCATCTCAGGTGG - Intronic
1084680271 11:70662776-70662798 CTCGGGGGCTGGATGTCATGTGG - Intronic
1084720486 11:70902486-70902508 CTTGGGGGCTGCCTCTCAGGGGG + Intronic
1084721120 11:70906301-70906323 CTTTGAGTGTGGCTCTCAGGTGG + Intronic
1084750644 11:71202551-71202573 CTCAGGAGCTGGCTTCCAGGTGG + Intronic
1085472416 11:76766768-76766790 GCCAGGGGCTGGCTCTGAGGAGG + Intergenic
1085678667 11:78549813-78549835 CTCTGATGCTGCCACTCAGGGGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086953078 11:92910378-92910400 CTCTGGAAATGGCTCTCAGCAGG - Intergenic
1087135229 11:94709853-94709875 CTCAGGGGCTTGATCTCAGCCGG - Intronic
1089198428 11:116708954-116708976 CTCTGGAGGTGGTTGTCAGGAGG - Intergenic
1090391745 11:126393344-126393366 CACTGGGGCAGGATATCAGGGGG + Intronic
1090993358 11:131840772-131840794 ATCTGGTGCTGGCTCACTGGAGG + Intronic
1202808438 11_KI270721v1_random:17237-17259 CTCTTGGGCTGGCCCCCAGGCGG + Intergenic
1091624719 12:2113224-2113246 CTCTGGGGCAGGCTCTCTCTAGG + Intronic
1091784111 12:3231890-3231912 GCCTGGGCCTGGCTCTCAGTGGG + Intronic
1095938803 12:47712415-47712437 CTCTCAGCCTGACTCTCAGGGGG - Intronic
1097957144 12:65497560-65497582 CCCTCTGGCTGGCACTCAGGGGG - Intergenic
1100784663 12:98066263-98066285 CCCTGGGGCTGGTTCTGGGGAGG - Intergenic
1101939100 12:109086065-109086087 AACTGGGGCTGGCTCCCAGGTGG - Exonic
1102141926 12:110622351-110622373 CCCTGGTGCTGGCATTCAGGAGG - Intronic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103569097 12:121832302-121832324 CTCTGGGGCTGGGGCTCCTGGGG - Exonic
1103738408 12:123075573-123075595 CTCATTGGCTGGCTTTCAGGCGG - Intronic
1103909291 12:124343257-124343279 CTCTGGGGCTGGCATTTACGGGG + Intronic
1104898608 12:132176108-132176130 CTTTGGCTCTGGCTCTGAGGGGG - Intergenic
1105000461 12:132687210-132687232 CTCTCGGGCCGGCCCTCCGGAGG - Intronic
1105911190 13:24869510-24869532 CTCTAGCTCAGGCTCTCAGGAGG + Intronic
1108574706 13:51781391-51781413 CACTGGGTCTGGCACTCAGTGGG - Intronic
1113745715 13:112742736-112742758 CAGTGTGGCTGGATCTCAGGGGG + Intronic
1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG + Intergenic
1117029205 14:51651793-51651815 GTCGGGGGCGGGGTCTCAGGGGG + Intronic
1118316903 14:64731173-64731195 CTCTGGGGCTGGGACGCTGGGGG + Intronic
1118807692 14:69251914-69251936 ATCTGGGGATGCCTCTGAGGAGG - Intergenic
1119544096 14:75459420-75459442 CTCTGCAGCTGACTCCCAGGTGG + Intronic
1121076193 14:91070334-91070356 CTCAGGTTTTGGCTCTCAGGAGG - Intronic
1121265495 14:92599640-92599662 CCCTGGGTCTGGTTCTCTGGAGG + Intronic
1121552246 14:94811699-94811721 ATGTGTGGCTGGATCTCAGGGGG + Intergenic
1122213491 14:100188387-100188409 CTCTGGGCCTTGCTCTATGGGGG - Intergenic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1123427593 15:20184870-20184892 TTCTGGGGTTGACTCTCAAGGGG - Intergenic
1123449170 15:20349578-20349600 GTCTGGGGCTGACACCCAGGAGG - Intergenic
1123536830 15:21191420-21191442 TTCTGGGGTTGACTCTCAAGGGG - Intergenic
1125584962 15:40813531-40813553 GTCTGGGTCTGGGTCACAGGAGG - Intronic
1125889955 15:43258514-43258536 GTCTGAGGCTGCCTCTGAGGAGG - Intronic
1126649818 15:50909017-50909039 CTCTGGGGTTAGCCCTCCGGCGG + Intronic
1127450169 15:59108923-59108945 CTTTGGGTTTGGCTTTCAGGAGG - Intronic
1127899662 15:63331540-63331562 CTCTGGGGCTGGCTGGTAAGAGG + Intronic
1128147505 15:65340176-65340198 CCCTAGATCTGGCTCTCAGGAGG - Intronic
1128462516 15:67881869-67881891 CCCCAGGGCTGGCTCTAAGGTGG - Intergenic
1128471425 15:67957005-67957027 TTCTGGGTTTTGCTCTCAGGAGG - Intergenic
1128643499 15:69358064-69358086 CTATGAGGAGGGCTCTCAGGAGG + Intronic
1128649646 15:69401145-69401167 CTCTGGGACTGGCTAGGAGGAGG + Intronic
1128784574 15:70385388-70385410 CCCTGAGGCTGCCTCTAAGGGGG - Intergenic
1128809791 15:70562450-70562472 CACCGTGGCTGGCTGTCAGGCGG - Intergenic
1129232906 15:74206536-74206558 CTCTGGAGCTGGCTTTAAAGGGG + Intronic
1129306860 15:74671659-74671681 CTCTGGTGCTGGCTGCCAAGTGG - Exonic
1129738001 15:77976434-77976456 CTCTGGAGCTGGCTCATAAGAGG + Intergenic
1130253842 15:82316761-82316783 CTCTGGAGCTGGCTCATAAGAGG + Intergenic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1131112096 15:89770862-89770884 CCCTCAGGCTGGCTCTAAGGAGG + Intronic
1132457111 16:30044-30066 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1132670881 16:1101930-1101952 CTCTGGGGCTGGAGCTTGGGGGG - Intergenic
1132959233 16:2612886-2612908 CTGTGGGAGTGGCTCGCAGGTGG + Intergenic
1132972293 16:2694861-2694883 CTGTGGGAGTGGCTCGCAGGTGG + Intronic
1134001868 16:10789159-10789181 CTCTGAAGCTGGCTACCAGGAGG - Intronic
1134017372 16:10898566-10898588 CTCTGGGCCTGGCACACAGTGGG - Intronic
1136010852 16:27362763-27362785 CTCTGGGTCGGGCTGGCAGGAGG - Exonic
1136685950 16:31995059-31995081 CTCAGGAGATGGCTCTCTGGGGG - Intergenic
1136786562 16:32938592-32938614 CTCAGGAGATGGCTCTCTGGGGG - Intergenic
1136883206 16:33915202-33915224 CTCAGGAGATGGCTCTCTGGGGG + Intergenic
1137270767 16:46901038-46901060 CAATGAGGCTGGCTCCCAGGAGG - Intronic
1137280732 16:46974068-46974090 CTCTGGGTCTGGCTCCCTCGGGG + Intergenic
1138129419 16:54466997-54467019 CTCTGGGGCTAGAAGTCAGGGGG - Intergenic
1139539835 16:67606569-67606591 TTCTTGTGCTGCCTCTCAGGTGG + Intronic
1141677227 16:85524185-85524207 CTCTCTGGCTGGCAGTCAGGTGG + Intergenic
1141764554 16:86049883-86049905 CACTGGGCCTGGCGCACAGGAGG - Intergenic
1141891426 16:86929169-86929191 CTCTGGAGAAGCCTCTCAGGAGG - Intergenic
1203088797 16_KI270728v1_random:1200258-1200280 CTCAGGAGATGGCTCTCTGGGGG - Intergenic
1142803670 17:2360552-2360574 TGCGGGGTCTGGCTCTCAGGAGG - Intronic
1143171601 17:4933764-4933786 CTCCGGGACGGGCTCTGAGGTGG - Exonic
1143368772 17:6425496-6425518 CTCTGTGGCTGGCTCTGCAGGGG + Exonic
1143631041 17:8140570-8140592 CCCTGGTGCTGCCCCTCAGGTGG - Exonic
1143707726 17:8711016-8711038 CTGTGGGGCTAGCTGTCAGCTGG - Intergenic
1143781162 17:9230453-9230475 ATATGGGGCTGGCACTCGGGGGG - Intronic
1144875469 17:18394909-18394931 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1145156756 17:20549512-20549534 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145293081 17:21565272-21565294 CTCTGGAGCTGGTGCTCAGATGG - Intronic
1145386888 17:22420654-22420676 CTCTGGAGCTGGTGCTCAGATGG + Intergenic
1145747819 17:27333052-27333074 CTCGGGCGCTGCCTCTCGGGCGG - Intergenic
1145798934 17:27671396-27671418 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145924807 17:28638507-28638529 CTCTGGGTAAGGCTCTCAGATGG - Exonic
1146160143 17:30555217-30555239 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1146466592 17:33091128-33091150 CCCAGGGCCTGGCCCTCAGGTGG + Intronic
1146673969 17:34760379-34760401 CTCTGTGCATGGCTCTCAGTGGG + Intergenic
1146844267 17:36173600-36173622 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146856572 17:36261535-36261557 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146864045 17:36326840-36326862 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1146872482 17:36385446-36385468 CTGTGGGGCTGATTCCCAGGAGG + Intronic
1146879840 17:36436531-36436553 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146883762 17:36457682-36457704 CTGTGGGGCTGACTCCCAGAAGG + Intergenic
1147066905 17:37927428-37927450 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147075366 17:37986070-37986092 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147078437 17:38006989-38007011 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147086891 17:38065616-38065638 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147094375 17:38130924-38130946 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1147102836 17:38189579-38189601 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1147146908 17:38490724-38490746 CTCAGGAGATGGCTCTCTGGGGG - Intronic
1147866644 17:43557390-43557412 GTCAGGGGCTGCCTTTCAGGAGG + Intronic
1148773009 17:50077691-50077713 CTCAGGGGCTGGCACACAGTTGG - Intronic
1148846344 17:50532402-50532424 CCCTGGGGCTGGCTCTTTGGTGG - Intergenic
1148913501 17:50955810-50955832 CTCTGCAGCTAACTCTCAGGGGG - Intergenic
1149847410 17:60016046-60016068 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1150085768 17:62272663-62272685 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1151139832 17:71980523-71980545 CTCTGGGCCAGGTTCTCAGCAGG + Intergenic
1151481986 17:74374987-74375009 CTGGGGGGCTGTCTTTCAGGAGG + Intergenic
1151575740 17:74951856-74951878 CTGCTGGGCAGGCTCTCAGGTGG + Intronic
1151758313 17:76087218-76087240 CCCTGGGACTGGAGCTCAGGGGG - Intronic
1151896000 17:76981419-76981441 TTTAGGGGCTGGCTCTCAGCTGG - Intergenic
1152007882 17:77693946-77693968 GGCAGGTGCTGGCTCTCAGGAGG + Intergenic
1152961100 18:80565-80587 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1156391487 18:36654642-36654664 TTTTGGGGCTGATTCTCAGGTGG + Intronic
1156499951 18:37551281-37551303 CTTTGGGGCTGGCTCTTTAGGGG - Intronic
1157493256 18:48138366-48138388 CTCTGGGGCAGGCTCCCTGCAGG - Intronic
1157805361 18:50653933-50653955 ATCTGGAGCTGGCACTCAGTCGG - Intronic
1159456535 18:68666491-68666513 CACTGGGGCTGCCTGTCATGAGG + Intergenic
1160509911 18:79447581-79447603 CTCTGAGGCTGGCGCTCATCGGG + Intronic
1161625054 19:5321588-5321610 CTCTGGGCCTGGCACACAGTGGG - Intronic
1161746724 19:6064659-6064681 CTCTAGAGATGGCTGTCAGGAGG - Intronic
1162020328 19:7865286-7865308 CCCTGTGCCTGGCTCTGAGGGGG + Intergenic
1162582556 19:11539869-11539891 CTCTGGGGCCGGCGCTGGGGGGG - Intronic
1162767832 19:12930622-12930644 CTCTGGGCCAGGCCCTCTGGGGG + Exonic
1163105529 19:15120970-15120992 CTCTTGGGCTGCCTCTCACAAGG - Intronic
1163127684 19:15253128-15253150 CCCTAGGGCCAGCTCTCAGGTGG + Intronic
1163302345 19:16455910-16455932 CACTGCGCCTGGCTTTCAGGAGG - Intronic
1163653367 19:18531828-18531850 GTGGGGGGCTGGCACTCAGGCGG + Exonic
1163678266 19:18666286-18666308 CCCTGAGCCTGGCTCACAGGAGG + Intronic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1164997413 19:32732429-32732451 CTCTGGGGCTGGGAACCAGGGGG + Intronic
1165031252 19:32999512-32999534 CTCTGTGGCTGGCTGTGAGCAGG + Intronic
1165074568 19:33273681-33273703 CCCTGGGCCTGGCTCACACGTGG + Intergenic
1165803191 19:38565406-38565428 CTCTGGGGCTCGCTGTTCGGCGG + Exonic
1166351497 19:42200674-42200696 CTCTGGGGCTGGCCCTGCGTAGG - Intronic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167698092 19:51026541-51026563 CTCTGGGGCTGGGGCTCTGGGGG + Intronic
926059212 2:9794667-9794689 ATCTGGGGCTGAGTCTCACGGGG - Intergenic
927157551 2:20229999-20230021 CCCTGGGCCTGGCTCCCAGTAGG - Intergenic
927194224 2:20536844-20536866 TCCTGGAGCTGGCTCTCAGCTGG + Intergenic
927634116 2:24799431-24799453 CTCTCGGGCTGTCTTTGAGGAGG + Intronic
927872722 2:26633809-26633831 CTCAGGGGCTGGCCCTAAGACGG + Intronic
929565879 2:42984509-42984531 CTCTGGGGGGGGCTCTCATTGGG - Intergenic
930700779 2:54456554-54456576 CACTGGGGCTGCCTCCCGGGTGG + Intronic
934736709 2:96693349-96693371 CTCTGCAGCTGACTCTGAGGGGG + Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935376117 2:102399513-102399535 GTCTAGGACTGGCTCTGAGGAGG + Intergenic
935590416 2:104842767-104842789 CTCTGGGGCGCGCTCACCGGAGG + Intergenic
937148568 2:119669487-119669509 TTCTGGGTCTGCCTCTCATGTGG + Intergenic
940128616 2:150355839-150355861 CTCTGGGGCAGTTTCTCAGTGGG - Intergenic
943623196 2:190172348-190172370 CTCTGTGGCTGGCTCTATGTTGG + Intronic
944893823 2:204144096-204144118 CTCTGGTTCTGGGTCCCAGGAGG + Intergenic
946014061 2:216589740-216589762 CTGTGGTTCTGGCTCTCACGGGG - Intergenic
947828812 2:233124724-233124746 CTCTGGGCATGGCTGTCTGGAGG + Intronic
947947445 2:234118480-234118502 CTCTGGGGCTGGGACATAGGAGG + Intergenic
948364200 2:237444211-237444233 CCCAGGGGCTGGATCTCCGGAGG - Intergenic
948513346 2:238487835-238487857 CACTGTGGCTGGCGCTCAGGAGG - Intergenic
948609413 2:239157280-239157302 CCATGGGGCTGTCTCTCAGAAGG + Intronic
948707519 2:239804338-239804360 CCCTAGGGCTGGCTCTCAGAGGG - Intergenic
948890072 2:240903277-240903299 CTGTGGGGTGGGCTCTCGGGAGG - Intergenic
949049145 2:241887919-241887941 GACTGGGGGTGGCTCTGAGGGGG + Intergenic
1170791459 20:19512493-19512515 CACTGGGCCTGGTTCTCTGGTGG - Intronic
1172068120 20:32235882-32235904 CTCTGGGCCTGGCTCAGTGGAGG - Exonic
1172903192 20:38349696-38349718 GGCTGGAGCTGGCTGTCAGGGGG + Intronic
1173534830 20:43801465-43801487 CCCCAGGCCTGGCTCTCAGGAGG - Intergenic
1174053591 20:47784129-47784151 CGCTGGAGCAGGTTCTCAGGGGG - Intronic
1174387340 20:50194954-50194976 CCCTTGGGCTGCCTCTAAGGAGG + Intergenic
1175038917 20:56027222-56027244 CTCTGGTGGTTGCTCTCTGGTGG + Intergenic
1175517610 20:59578910-59578932 CACTGGGACTGGCGCTCAGTAGG - Intronic
1175795044 20:61765977-61765999 CTCTGGGATTGGCTCCCAGGAGG + Intronic
1176121090 20:63454912-63454934 CTGTGGGCCTGGGTCTGAGGTGG - Intronic
1177551140 21:22624126-22624148 CTCTTGGGGTGGCTCTCAGGTGG - Intergenic
1178096736 21:29223270-29223292 CGCTGGGGCTGGCAGTCTGGGGG - Intronic
1178707275 21:34886625-34886647 TTCTGGGGCGGCCTCCCAGGAGG - Intronic
1178958298 21:37042618-37042640 CCCTGGGGCCGACTCTCAGGCGG - Intergenic
1179164017 21:38921099-38921121 GTCTGGGGCTGGCTCTGGGCTGG - Intergenic
1179193291 21:39141735-39141757 CTCTGCAGCTGGCTATCATGAGG + Intergenic
1179313836 21:40223185-40223207 CTCTGAGGGTGAGTCTCAGGAGG - Intronic
1179665435 21:42908855-42908877 CACTGGGGCTGGCTCTGCGGAGG - Exonic
1180228542 21:46412770-46412792 TGCTGGGGCTGCCCCTCAGGTGG - Intronic
1180979220 22:19870945-19870967 CCCTGTGGCTGACGCTCAGGGGG + Intergenic
1180980512 22:19876145-19876167 CTCTGGGGAGGCCTCTCTGGGGG - Intronic
1181537322 22:23553234-23553256 ATCTGTGGCTGGCACTGAGGTGG - Intergenic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1182075514 22:27492882-27492904 CCTTGGGGCTGGCTGTCAAGTGG + Intergenic
1182270418 22:29149821-29149843 CCCTGGTGCTGGCTCCCGGGTGG - Intronic
1182414185 22:30210445-30210467 CTCAGGGGCTGGCTCTGGGCAGG + Intergenic
1182444100 22:30380263-30380285 CCCTGGGGCTGGCTCCCACCTGG + Exonic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1182761194 22:32723651-32723673 CTCTGGGCTCGGCTCCCAGGAGG + Intronic
1183193324 22:36335808-36335830 TTCTGGGGCTGGCTCTCTGCGGG + Intronic
1183655680 22:39183411-39183433 CTCTTGGGCTGGCTCTCCCATGG + Intergenic
1183728729 22:39605065-39605087 CTCTGGGGATGGGTCTTGGGTGG - Intronic
1183784704 22:40022678-40022700 CTCTGGGGTGGCCTTTCAGGTGG + Intronic
1184101825 22:42344796-42344818 CTCTGGGCCTGGCCCACAGTAGG + Intergenic
1184730427 22:46368513-46368535 CGCAGGGGCTGGGTGTCAGGAGG - Intronic
1185266241 22:49905853-49905875 CTTTGGGGCAGGCACTTAGGAGG - Intronic
949980624 3:9499983-9500005 CTCTCGGGCAGCCTCTCAGCTGG + Exonic
950101602 3:10360199-10360221 CTCTGGGACTGCCACTTAGGTGG + Intronic
950467177 3:13162400-13162422 CCCTGGGGCTGGCTCTGAGGTGG - Intergenic
950808847 3:15632329-15632351 CCCTGGGGCTGGCCCACAGTTGG + Intronic
950880387 3:16318157-16318179 AGCTGGGGCTCGCTCTCGGGTGG - Intronic
951211527 3:19980787-19980809 CTCTGGGACTGGCTCTGGGCTGG - Intronic
952866171 3:37856595-37856617 CTCTGGGCCTGGTTCCCAGTAGG + Intergenic
952960927 3:38588728-38588750 CGCTGGGGTTGGCAATCAGGTGG + Intronic
954647762 3:52141946-52141968 CTCTTTGGCTGGCTGTCAGCAGG - Intronic
955318738 3:57959381-57959403 CTCTGTGGCCAGCTGTCAGGAGG - Intergenic
955864736 3:63371222-63371244 CTGTGGGGTGGGCTCACAGGGGG - Intronic
961078163 3:124000978-124001000 CTCCTGGGCTGGCTCCCAGGAGG - Intergenic
961327648 3:126118783-126118805 CTCTGTGGCTGGCTCACCTGAGG - Intronic
961438693 3:126937696-126937718 CTCTGGGACAGGCTCTGATGAGG - Intronic
964271039 3:154957130-154957152 TTCTGAGGCTGGATCTCAAGAGG - Intergenic
964632427 3:158826119-158826141 CTCTGGGTCTGCCTCTTTGGGGG + Intronic
966509823 3:180749448-180749470 CTCTGGGAAAAGCTCTCAGGAGG + Intronic
967844221 3:194031576-194031598 AGCTGGGGCTGGCTCTCCAGAGG + Intergenic
968588946 4:1448294-1448316 CACAGGGGCTGGGTCTCAGAAGG + Intergenic
968864840 4:3201967-3201989 CTCTCAGGCTGGCTCCCAGATGG + Intronic
968901218 4:3432797-3432819 CTCTTGGGCTGTCTCCTAGGAGG + Intronic
968957185 4:3725398-3725420 TTCCGGGGCTGGCTCTCTGTGGG + Intergenic
968968131 4:3779694-3779716 CTCGGGCGCTGGCTCCCCGGAGG + Intergenic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
970114082 4:12673480-12673502 CTTTGGGACTGGCTATCAGTGGG - Intergenic
972614228 4:40682874-40682896 CGCTGGTGCTGGCTCTTAGCTGG - Intergenic
974194305 4:58551885-58551907 AGCTGGGGTTGGCTCTCAGTTGG - Intergenic
975172448 4:71247707-71247729 CTCTGTGTTTGGCTCACAGGTGG + Intronic
976628083 4:87208094-87208116 CTCTGGGGCTGGTGGTCTGGTGG - Intronic
977822593 4:101491460-101491482 ATCTTGTTCTGGCTCTCAGGGGG + Intronic
979206729 4:118046744-118046766 TTCTGTGGCTGGCACTCAAGTGG + Intronic
979670690 4:123357414-123357436 GGCTGGGGCTGGGTTTCAGGAGG - Intergenic
980108842 4:128615212-128615234 CTGTGGGCCTGTCTCTGAGGAGG - Intergenic
982718669 4:158837087-158837109 GTCAGGGGCTGGGTCGCAGGTGG - Intronic
984122007 4:175757260-175757282 GGCTGGTGCTGGCTCTCAGGGGG - Intronic
984712710 4:182899136-182899158 CTGTGGAGCTGGCTCTCATCAGG - Intronic
990470743 5:56113007-56113029 CCCTGGGGCTCTCTCTCTGGTGG - Intronic
990708740 5:58559610-58559632 CTGTAGGGCTGGATATCAGGAGG - Intergenic
990859762 5:60314011-60314033 GTCTTGTGCTGGCTCTCAAGGGG - Intronic
992497856 5:77310679-77310701 CTCTGTGGGGGGTTCTCAGGAGG - Intronic
994822166 5:104667674-104667696 CTCTGGTGCTCTTTCTCAGGAGG + Intergenic
997802084 5:136873708-136873730 CTGAGGGGATGGCTCCCAGGGGG - Intergenic
998500844 5:142631295-142631317 TTCTGCAGCAGGCTCTCAGGAGG - Intronic
999102865 5:149041378-149041400 CTCTGGGACTTGCTCCCAGGAGG + Intronic
999693065 5:154165630-154165652 CTCTGGGGCTGGCTGTGGAGTGG + Intronic
1001098848 5:168797298-168797320 CTCTGGGGCTGCCAGTCAGGTGG + Intronic
1001651305 5:173318070-173318092 ACCTGGGGCTGGCGCTCGGGGGG + Exonic
1001797475 5:174514310-174514332 CGCTGGGGCTGGTGGTCAGGGGG - Intergenic
1002089541 5:176796334-176796356 CTCTGGGGCTGCCCTGCAGGTGG + Intergenic
1002160099 5:177309954-177309976 CCCTGGAGCTGCCTCCCAGGTGG + Intronic
1002562204 5:180090226-180090248 CTCAGCCGCGGGCTCTCAGGAGG + Intergenic
1002565811 5:180112617-180112639 GGGTGGGGCTGGCTCTCAGTGGG + Intronic
1003167825 6:3696844-3696866 CTCTGCTGCTGGCTCTGTGGTGG - Intergenic
1003461737 6:6334984-6335006 CTCTTGGGGTGGCTCCCAGGAGG + Intergenic
1004993767 6:21168250-21168272 CTTTGGATCTGGTTCTCAGGAGG - Intronic
1006272531 6:32975090-32975112 CTCTGGGGCTGGCTATCCATGGG - Intronic
1007472127 6:42097810-42097832 CCCTGTGGCTGGCTCACTGGTGG + Intergenic
1011014110 6:82735967-82735989 CCATGGGGCTCACTCTCAGGAGG + Intergenic
1012221788 6:96657799-96657821 ATCTGTGGCTGGCACTCAAGTGG + Intergenic
1015582265 6:134738511-134738533 CTCTGGGCTTGGCACTTAGGAGG - Intergenic
1017130740 6:151106537-151106559 CTCAGGGGCTGGCTCGGGGGTGG - Intergenic
1018167863 6:161116300-161116322 ACCTGGGGCTGGCACTCAAGAGG + Intronic
1018395565 6:163375599-163375621 CCCTGGAGCTGGCACCCAGGGGG + Intergenic
1019334232 7:475473-475495 CTCTGGTCCTGGCTCTGTGGAGG + Intergenic
1019412367 7:911902-911924 CTGTGGGGCTGCCCCTCGGGGGG - Intronic
1019597855 7:1866645-1866667 CTCTGGGGCTGGCCGGCAAGAGG - Intronic
1019665971 7:2252540-2252562 CCCTGGGGTTGGCTCTGTGGAGG - Exonic
1020014164 7:4821247-4821269 CTGTGGGGTGGGCTGTCAGGCGG - Intronic
1020098049 7:5379517-5379539 CTCAGGGGCTGGCTATAGGGAGG - Intronic
1023861809 7:44221260-44221282 CCCAGGGGCTGGCTCACGGGAGG - Intronic
1023995082 7:45154840-45154862 CTCTGGGGCTAGACTTCAGGAGG - Intergenic
1024083230 7:45873018-45873040 CTCTGGGGCTGGCTTCCAAGTGG + Intergenic
1024731049 7:52254287-52254309 CTCTGGGGCTCTCTCTGTGGGGG - Intergenic
1025174108 7:56788243-56788265 CTCTGGCTCAGGCTCTCACGAGG + Intergenic
1025697689 7:63788182-63788204 CTCTGGCTCAGGCTCTCACGAGG - Intergenic
1025829410 7:65036865-65036887 CTCTGGCTCAGGCTCTCATGAGG - Intergenic
1025916628 7:65871805-65871827 CTCTGGCTCAGGCTCTCATGAGG - Intergenic
1026355477 7:69553486-69553508 CCTTGGGGCTGACCCTCAGGTGG + Intergenic
1026622385 7:71961440-71961462 CTATGGGGCTGACTCCCAAGGGG - Intronic
1026794025 7:73354372-73354394 CTGTGGCCCTGGCTCTCTGGCGG - Intronic
1026978371 7:74512544-74512566 CCCTGGGGCTGGGGCTAAGGGGG + Intronic
1027259372 7:76453669-76453691 TTCTGGGGCTGTATCACAGGGGG + Intergenic
1027310743 7:76951751-76951773 TTCTGGGGCTGTATCACAGGGGG + Intergenic
1029055157 7:97733325-97733347 ATCTGGGGCTGGGGCTCCGGTGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030250453 7:107438286-107438308 CTCTGGTGCTGCCTCTGAGCTGG - Intronic
1030732646 7:113008227-113008249 GTCTTGTGCTGGTTCTCAGGGGG + Intergenic
1032262185 7:130346765-130346787 CTCCGGGGCTGGCTCGTTGGTGG + Intronic
1032547205 7:132753885-132753907 TGCTGAGGCTGGCTCTGAGGTGG - Intergenic
1033118513 7:138646993-138647015 CTCTGGGGCCAGCTGTCATGAGG + Intronic
1034228555 7:149501231-149501253 CTCTGGGGTTGGCTGGCTGGAGG + Intergenic
1035643913 8:1203911-1203933 CCCAGGGGCAGGCTCACAGGTGG - Intergenic
1036663115 8:10721133-10721155 CTCTGAGGCTGGGTCTGATGTGG - Intergenic
1036740385 8:11355873-11355895 CACAGGGCCTGGCTCACAGGAGG + Intergenic
1037695954 8:21224104-21224126 CTCTGGGCAGGGCTCTCTGGTGG + Intergenic
1038038220 8:23703943-23703965 CTCGGTGACAGGCTCTCAGGAGG + Intronic
1039149762 8:34490890-34490912 CTCTGTGGCTAGCTGACAGGAGG - Intergenic
1039360399 8:36870529-36870551 CTCAGAGGCTGGCTCTCAGTAGG - Intronic
1040892018 8:52326999-52327021 CTGTGGGGCTCCCTCTCCGGTGG - Intronic
1043793289 8:84501732-84501754 CTCTGGGGATGGCTCACAAATGG + Intronic
1046231615 8:111365320-111365342 CTTTGGAGCTGGGTATCAGGTGG - Intergenic
1048444999 8:134486637-134486659 ATCTGGGGCTGCCTCCCAGCAGG - Intronic
1048872016 8:138806969-138806991 CTCAGGGCCTGGCCCTCAGCAGG + Intronic
1049225446 8:141448566-141448588 CTCTGTGGCTGGCACACAGCAGG + Intergenic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049582043 8:143417198-143417220 TTCTGGGCCTGGCACACAGGTGG - Intergenic
1049655017 8:143793491-143793513 AGCTGGGGCTGGGTCTCATGGGG + Intronic
1049803240 8:144527737-144527759 CGCTGCGGTTGGGTCTCAGGCGG + Exonic
1050393022 9:5167132-5167154 CTGTGTGGCTGGCTCCCAGGTGG - Intronic
1052846840 9:33344307-33344329 CTCAGGGGCTGGTTCTCTGAAGG + Intronic
1053368010 9:37537517-37537539 CTCCAAGGCTGGCTCACAGGAGG - Exonic
1056753003 9:89365163-89365185 CTCTGGGGCTGGAGCTTAGTGGG - Intronic
1056773477 9:89496222-89496244 CTCTGGGTGTGCTTCTCAGGAGG + Intronic
1056786127 9:89593759-89593781 TTCGGAGGCTGGCTCTCAGCAGG + Intergenic
1057919830 9:99087978-99088000 CTTGGGGGCTTGTTCTCAGGAGG - Intergenic
1059476007 9:114548229-114548251 AGCTGGGGCTGGCTGTCAGCTGG + Intergenic
1060268873 9:122127553-122127575 CTCCCGTGCTGGCTCCCAGGAGG + Intergenic
1061303908 9:129721927-129721949 CCCTGGGCCTGGCTCTCAGCAGG - Intronic
1061626447 9:131843308-131843330 CTCTCATGCTGGCTCTGAGGGGG - Intergenic
1062737061 9:138143421-138143443 CTCTGGGTGTGGACCTCAGGAGG + Intergenic
1186461500 X:9751968-9751990 CTCTGGGGCTGGCCCCCAGCAGG - Intronic
1186776737 X:12872314-12872336 CTCTTGGGGTGGCAGTCAGGCGG + Intronic
1186940063 X:14496863-14496885 CTCTGGTGCTGGCCTTCAGCTGG + Intergenic
1187869785 X:23755007-23755029 ATCAGGGGCTGGCACTCTGGTGG - Intronic
1191779165 X:64848007-64848029 CTCTTGGACTGGCTCTAATGTGG - Intergenic
1192784639 X:74324438-74324460 CCCTGGGCCAGACTCTCAGGAGG - Intergenic
1192803989 X:74493897-74493919 CCCTGGGCCAGACTCTCAGGCGG + Intronic
1198478572 X:137019081-137019103 CTCTGGGGGTGTCACCCAGGTGG + Intergenic
1198933235 X:141881278-141881300 CCCTGGGGAGGACTCTCAGGAGG - Intronic
1199145660 X:144363074-144363096 CTCTGAAGCTGGCTCGCTGGAGG - Intergenic
1199638133 X:149832956-149832978 CTCAGGGGCTGGCCCACAGGGGG - Intergenic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1200399248 X:156009682-156009704 CTCTGGGTGTGGACCTCAGGAGG + Intronic
1200934763 Y:8728673-8728695 CTGTGGGGCTCTCTCTCAGGTGG - Intergenic