ID: 1080683554

View in Genome Browser
Species Human (GRCh38)
Location 11:34497055-34497077
Sequence TTGAAGAATCAGAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 776}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080683552_1080683554 11 Left 1080683552 11:34497021-34497043 CCTGACTAGAAAAAATAAAAAAT 0: 1
1: 0
2: 56
3: 689
4: 6377
Right 1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG 0: 1
1: 0
2: 6
3: 70
4: 776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080683554 Original CRISPR TTGAAGAATCAGAAAGAGGA TGG Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901259070 1:7857948-7857970 ATGAAGTCTCACAAAGAGGAAGG + Intergenic
901366833 1:8759356-8759378 ATGAAGAATTAGAAAGAAAAAGG + Intronic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902472649 1:16659457-16659479 TTGAATAATTAGAAATGGGAAGG + Intergenic
902486155 1:16747986-16748008 TTGAATAATTAGAAATGGGAAGG - Intronic
902586121 1:17439407-17439429 TTGAAGGAATAAAAAGAGGAAGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903542358 1:24103934-24103956 TTAAAGAATCAGAGAGATGGAGG - Intronic
903606174 1:24576559-24576581 TGGAAGAGTCACAAGGAGGAAGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904476974 1:30771626-30771648 TTAAAAAATCAGAAAGGAGATGG + Intergenic
904597053 1:31653529-31653551 TAGAAGAAACAGAAAGAAAAGGG + Intronic
904700346 1:32354209-32354231 TAAAAGTATCTGAAAGAGGAAGG - Intronic
904944585 1:34189938-34189960 TGGAAGAAGGAGAAAGAGCAAGG - Intronic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
908039807 1:60099199-60099221 TGGAAAAATCAGACAGAGAAAGG - Intergenic
908643583 1:66252129-66252151 TTGAAGGATAAGGAAGAGGGAGG + Intronic
908897809 1:68920331-68920353 ATGAAGAATGAGAAAGGGAATGG - Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909201764 1:72698406-72698428 TTCAAGAAACAAAAAGATGAGGG + Intergenic
909425558 1:75520558-75520580 AGAAAGAATGAGAAAGAGGAGGG + Intronic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910382564 1:86644530-86644552 TTTAAAAATCACAAAGAGGCTGG + Intergenic
910714226 1:90213414-90213436 GTGAAGTATCAGAAAGAGAGTGG - Intergenic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
910934566 1:92476682-92476704 TTCAAGAACAAGAAAGAAGACGG - Intronic
912165924 1:107042130-107042152 TTGTTGATTCAGAAAGAGGTGGG - Intergenic
913455916 1:119030608-119030630 TAGAAGAAAAAGACAGAGGAAGG + Intergenic
913487797 1:119349378-119349400 TTGGAAAATCAGAAAGAAAAAGG + Intergenic
913613589 1:120533027-120533049 TTGAAGACTGAGAAAGTTGAAGG + Intergenic
914577483 1:148988224-148988246 TTGAAGACTGAGAAAGTTGAAGG - Intronic
914955142 1:152155248-152155270 TTGAACAATCAGGAAGATCAGGG - Exonic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915506186 1:156357785-156357807 TGGAGGAATCAGAAGGAGAAGGG + Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916498883 1:165369598-165369620 TAGAAAAACCAGAAAGAAGATGG - Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
917130822 1:171741281-171741303 AAGACGAATCAGAAAGAGAATGG - Intronic
917711079 1:177685881-177685903 TTTAAACATCAGAAAAAGGATGG - Intergenic
917904689 1:179576729-179576751 TTGAAGAATCATAGGCAGGAAGG + Intergenic
917932373 1:179831768-179831790 TTGTAGAATCACAAAGATGTAGG - Intergenic
918104870 1:181408234-181408256 TGGAGGAATCAGAAAGAGAGTGG + Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919427417 1:197449935-197449957 TTGAAGAACCAGAGAAAAGAGGG - Intronic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920622921 1:207565990-207566012 TTGAAGAATCACATTGAGGGAGG - Intronic
920663661 1:207942524-207942546 TGAAAGAAAAAGAAAGAGGAAGG - Intergenic
920871129 1:209796116-209796138 TTAAAGCATTAGAAAGTGGAGGG - Intronic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
922095495 1:222439800-222439822 TTGAAAAAGCAGAAAGTGAAAGG + Intergenic
922486262 1:225975603-225975625 TTAAGGAATCAGAAAGAACAGGG + Intergenic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923293607 1:232571762-232571784 TGGAAGAATCAGACAGAAGGGGG - Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923629004 1:235637354-235637376 TTAAAGAATTAGAATGAGGCTGG + Intronic
1064777375 10:18793838-18793860 TTGAAGGATAAAATAGAGGAGGG + Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064857999 10:19793240-19793262 AGGAAGAATGAGAAAGAGAAGGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065261373 10:23926811-23926833 TTGAAGGATCGAAAAGAGGGAGG - Intronic
1065284574 10:24175194-24175216 TTGAAGACTCGGGAAAAGGATGG - Intronic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066409358 10:35151003-35151025 TTATAGAATAAGTAAGAGGAGGG + Intronic
1066526201 10:36282679-36282701 TTTAAGAGTCAGAAAGAGTAGGG - Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1068562422 10:58530244-58530266 TTGAAGAATCAAATAGAAAAAGG + Intronic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068626385 10:59253050-59253072 TTGAGGAAACAAAAACAGGAAGG + Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1069024362 10:63523296-63523318 TTGGAGAATCAGAAAAGGCAAGG + Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070074512 10:73122153-73122175 TCTAAGAAACAGAAAGGGGAAGG - Exonic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070405520 10:76091469-76091491 TTGAAGGATCAGAAAGTAAATGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070629340 10:78073646-78073668 TTGAAGACCCTGAGAGAGGAAGG - Intergenic
1070724136 10:78776938-78776960 TCCCAGCATCAGAAAGAGGAAGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070982529 10:80660910-80660932 TTGTTGCAACAGAAAGAGGAAGG - Intergenic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1072140154 10:92582505-92582527 TTGCAAAATAAAAAAGAGGAGGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1073667059 10:105545377-105545399 GTGAAGAACCAGAAAGAAAATGG - Intergenic
1073685199 10:105745058-105745080 TTGAAGAATGAGAGAGAGAAGGG + Intergenic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1075621756 10:123933420-123933442 TTTAAGAATCAAAAACAGGCTGG + Intronic
1076143892 10:128101394-128101416 ATGCAGAATCAGAAAGGGAAAGG - Exonic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1077890723 11:6416322-6416344 TTATAGGATGAGAAAGAGGAAGG - Intronic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1078745751 11:14112821-14112843 TGGAAGAATTAGAAGGAGCAAGG - Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079928782 11:26531220-26531242 TAGAAGAATCAAAAACTGGATGG + Exonic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1082741445 11:56916037-56916059 TAGAAGAACCAGAACCAGGATGG - Intergenic
1083134489 11:60659084-60659106 TTGAAGAATAATAAAGAGAGTGG + Intergenic
1083751461 11:64763173-64763195 TGGCAGAATCAGAGAGAGAAAGG - Intergenic
1084465199 11:69319250-69319272 ATGAAGAATATGAGAGAGGAAGG - Intronic
1086535201 11:87835901-87835923 TTGAAGAATCAGGCAAAGCAAGG - Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1087114348 11:94508705-94508727 TTGAAAAATAAGAAAGAAGTTGG - Intergenic
1087269672 11:96098637-96098659 TGGAAGAATGAGAACAAGGACGG - Intronic
1087333940 11:96818855-96818877 TTGAAGGATAATAAAGAGGTAGG - Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1089961644 11:122622212-122622234 TTTAAGAAACAGAGAGAGCAGGG + Intergenic
1089995581 11:122903974-122903996 TGGAAGAGTAAGAAGGAGGAAGG + Exonic
1090122751 11:124049953-124049975 GTGAAGAATAAGAGAGATGATGG - Intergenic
1090446729 11:126770806-126770828 TGGAAGGGGCAGAAAGAGGAAGG + Intronic
1090788315 11:130069438-130069460 TTCCAGAATCAAAAAGAGGGCGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091111213 11:132970169-132970191 ATGAAGCATGTGAAAGAGGAGGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091621565 12:2093137-2093159 TTACAGAGTCAGAAAGAGCAAGG + Intronic
1091646858 12:2279364-2279386 ATGAAAAATCACAAAGATGAAGG - Intronic
1091661655 12:2388528-2388550 ATGAAGAATCTGAGAGAGGTAGG + Intronic
1091788251 12:3256154-3256176 TGAAAGAATGAGAAAGAGGGAGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092966202 12:13645864-13645886 TTTAAGTAACAGAAAGAGAAGGG + Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093103999 12:15064149-15064171 TTGAGAAATAAGAAAGAGTAAGG - Intergenic
1093897837 12:24594782-24594804 TTGAAGATTCAGAAACAGTCTGG - Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094123831 12:27001621-27001643 TTGAAGGAAAAGAGAGAGGATGG - Intronic
1094332477 12:29310063-29310085 TAGAAAAATCAGAAATCGGAAGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095542416 12:43325967-43325989 TTACAGCATCAGAAAAAGGAAGG + Intergenic
1095823663 12:46508638-46508660 ATAAAGAATGAGGAAGAGGATGG + Intergenic
1096000659 12:48127242-48127264 TTGAAGGAACAGGAAGGGGAAGG - Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1097313721 12:58150039-58150061 TGGAAGAATTACAAAGAGCATGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1098536022 12:71594392-71594414 TGGAAAAATCAGTAAGAGGCTGG + Intergenic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099098669 12:78408465-78408487 TTGAAGAATAATAAACAGGGAGG + Intergenic
1099415786 12:82384417-82384439 TTAAAGATTCAGAGAGAGGGAGG - Intronic
1099600033 12:84723234-84723256 TGGAAGAATGAGAAAGTGGGAGG - Intergenic
1099930695 12:89070992-89071014 TTTAAGAATCTGGAAGAGAATGG - Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1101132179 12:101700200-101700222 TTGAACACTTAGAAAGAGCAGGG + Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103102099 12:118186673-118186695 TTGAAGAATTAGGAAAAGGAAGG - Intronic
1104264485 12:127218879-127218901 TTGAAGAGAGAGAAAGAGCATGG + Intergenic
1104625085 12:130345861-130345883 TTAAAGAATCAAAAACAGGTAGG + Exonic
1104641516 12:130470214-130470236 TTGTAGGATCAGAGAAAGGAGGG - Intronic
1104855691 12:131901539-131901561 GTGAAGAATGAGAAAGCAGAGGG - Intronic
1104881735 12:132076201-132076223 TGAAAGAATCAGACTGAGGATGG - Intronic
1105205669 13:18221508-18221530 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1105945747 13:25187985-25188007 GGGAAGAATCAGAAAGGAGATGG - Intergenic
1105968954 13:25410240-25410262 TTCAATAATCAGAAACTGGAGGG - Intronic
1106250946 13:27981084-27981106 GTGAGGAATCAGGTAGAGGATGG + Intronic
1107160578 13:37222597-37222619 TTGAAGATGCAGAAAAAGAATGG - Intergenic
1107716238 13:43202204-43202226 TGGAAGAATGAGAAAGATGTGGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108216920 13:48194519-48194541 TTAAAGAGTCAGAGAGAGAAGGG - Intergenic
1108256205 13:48613375-48613397 AGGAAGAGTCAGAAACAGGAGGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109820642 13:67648081-67648103 TTGAAAAAAAAGAAAGGGGAAGG + Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1110468554 13:75830868-75830890 TTGAAGAATAAAAGACAGGATGG - Intronic
1110492871 13:76129482-76129504 TTGAGGCATCAGAAAGGGCATGG - Intergenic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112992772 13:105534361-105534383 TTGAAGAAACAGTAAGGGGTAGG + Intergenic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1113025734 13:105938916-105938938 TTGAAGAATGAGAAAGGTGAAGG - Intergenic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1113149467 13:107246057-107246079 GTGCAGAATGAGATAGAGGAGGG - Intronic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116403310 14:44535947-44535969 TTGAAAAACAAGAAAGGGGAGGG + Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116964194 14:50997765-50997787 TTGAAGAAGCTGAAAAATGAAGG - Intronic
1117018525 14:51545084-51545106 TTAAAGAATGATAAAAAGGATGG - Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117248610 14:53912624-53912646 TTCAAAAGTCAGAAAGAGTAGGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117637210 14:57755993-57756015 TAGCAGAGTCAGAAAGAGTAAGG - Intronic
1118231036 14:63950116-63950138 TGGAAGAAGCACAGAGAGGAAGG - Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118530014 14:66693899-66693921 TTGAAGAATAAGAAAAAAGTTGG + Intronic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1118965278 14:70576968-70576990 GTGAAGAATAAGCAAGAAGAAGG + Intergenic
1118979477 14:70704688-70704710 TAAAAGACTCAGAAAGAGAAAGG + Intergenic
1119755154 14:77112396-77112418 TTTTAGAGTCAGACAGAGGATGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120051604 14:79873512-79873534 TGGAAGAATGAGGAAGAGAAAGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120698811 14:87675177-87675199 TTTAATAATCAGAAAGAGTGAGG - Intergenic
1120802578 14:88708483-88708505 TTGAAGAAAGAGAAAAAGAAAGG + Intronic
1121018066 14:90560522-90560544 TTGAGGATTCAGAAAGGGAAAGG + Intronic
1121421208 14:93816435-93816457 TTGAGGAATAAAAAAGAGAAAGG - Intergenic
1121564380 14:94897763-94897785 TTGCAGAATGAGAGAGTGGAGGG - Intergenic
1121718515 14:96093008-96093030 TTTCAGAATCAGAGATAGGATGG - Exonic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1124204730 15:27707489-27707511 AGGATGAATCTGAAAGAGGAAGG - Intergenic
1124795690 15:32775900-32775922 TTGAAAAATCCGAGAGAGGAGGG + Intronic
1125146426 15:36474213-36474235 GTTAAGAATCAGATAAAGGATGG + Intergenic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126885727 15:53147771-53147793 TTGAGGAAAGAGAAAGAGTAAGG + Intergenic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1127349649 15:58137757-58137779 TCCAAGAATCAGAAAGATGGAGG - Intronic
1127489832 15:59452107-59452129 CTGAAGAATCAGGAAGAGATGGG - Intronic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128611189 15:69074705-69074727 TTGAAGCATTAGCAAGAGGGTGG - Intergenic
1128622967 15:69167450-69167472 TTTAAGAAAGAAAAAGAGGAAGG - Intronic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1128835605 15:70806920-70806942 ATGAAGCATGGGAAAGAGGAGGG + Intergenic
1128963726 15:72036585-72036607 CTGAAGAATCAGAACAGGGATGG + Intronic
1129027682 15:72593742-72593764 TTGAAAAATAACAAAAAGGAAGG - Exonic
1129085717 15:73088906-73088928 AAGAAGATTCAGAAAGAGTAAGG + Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1130103892 15:80914665-80914687 TTCAAGAAACTGAAAGAGGGAGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130710481 15:86275903-86275925 ATGAAGAATCTGAAAGAAGTTGG - Intronic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1131650446 15:94392516-94392538 TTAAAAAATCAGAAACAGGCTGG + Intronic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132134295 15:99319346-99319368 TTGAAGAATGAGGAAGATAAAGG + Intronic
1132774219 16:1582973-1582995 TTGAAGTTTCAGACAGAGGCTGG + Intronic
1133235851 16:4387108-4387130 TTGAAGTTTCAGAAGGCGGATGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1134294622 16:12934773-12934795 TTGAAGGATGAGAGAGATGAGGG - Intronic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1136537169 16:30906785-30906807 TTGAAGAGTCAGTAAGATAATGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137830220 16:51537104-51537126 ATGAAGACTCAGAAAGACTAAGG - Intergenic
1138060369 16:53883805-53883827 TTGAAGAATCAGAGATTGGGGGG - Intronic
1139092101 16:63660612-63660634 TAGAAGAATTTCAAAGAGGAGGG + Intergenic
1139150248 16:64373454-64373476 TTGAAAAATCAGACAAAGCAAGG + Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1139364471 16:66425516-66425538 ATGAAGGATCAGAGAAAGGAGGG - Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141801123 16:86309957-86309979 TTGAGGAAGCAGACAGAGGCTGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143716763 17:8777589-8777611 TTGAATTATCCCAAAGAGGATGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144377199 17:14656241-14656263 TTGAAAAATCAGGGAGAGAAAGG - Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146272453 17:31493309-31493331 TTGAGGTACCAGAAAGAGGAAGG + Intronic
1146438192 17:32871060-32871082 TTGAAGGATGAGTAAGAGTATGG + Intronic
1146571419 17:33956559-33956581 TTGAAGGATTAGTAAGAGGTAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1147422991 17:40331837-40331859 TTGAAGGAGCAGACCGAGGAAGG + Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148667630 17:49386685-49386707 TGGAAGTATGACAAAGAGGAAGG - Intronic
1148703058 17:49602930-49602952 TTGAGGGATAGGAAAGAGGAAGG + Intronic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150800006 17:68273861-68273883 TTGAAGAACAAGGAAGGGGAAGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152391851 17:80008172-80008194 TTGAAGAACCAGCAAGGCGAAGG + Intronic
1152673083 17:81620666-81620688 TTTAATAATTAAAAAGAGGAGGG + Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153486699 18:5605719-5605741 TTCTAAAATCAGAAAGAGGTTGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1155530307 18:26759928-26759950 TTGGAGAATCTGGTAGAGGAAGG + Intergenic
1156619478 18:38832309-38832331 GTGAAGGATCACAAAGAGGCAGG - Intergenic
1157675050 18:49562457-49562479 TTGAAGAATCAGCAAGACAGAGG - Intronic
1157968725 18:52240631-52240653 TTGAAGAATATGAAATAGAAGGG - Intergenic
1158508299 18:58066789-58066811 TGGAAGAATCAGGAGGAAGAGGG + Intronic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1159029795 18:63219146-63219168 TTGGAGAATCAGAAAAAGCCTGG - Intronic
1159790301 18:72770874-72770896 TTAAAGAATCAAAGAGAAGAGGG - Intronic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1161133537 19:2606085-2606107 TTTAAGAGTCAGGAAGAGGCTGG + Intronic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161993705 19:7699516-7699538 GTGTTGAATCAGAAAAAGGAGGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
1164447831 19:28332847-28332869 TAGAAGAATAAGAAAAAGCAAGG + Intergenic
1165021909 19:32931883-32931905 TTGAAAAATCATACAGAGGCCGG + Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166576310 19:43841731-43841753 TTCAAAAATAAGAAAGATGAAGG - Intronic
1166691658 19:44825183-44825205 ATGAAATATCAGAAAGAGGCAGG + Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167110561 19:47458200-47458222 ATGAACAGTCAGAAAGAGGTGGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167602859 19:50464761-50464783 TTGAAGGACAAGGAAGAGGAAGG + Intronic
1167634259 19:50644891-50644913 ATGAAGAGTTAGATAGAGGATGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168108066 19:54176316-54176338 TTGAAGAACCAGAAAGCCAATGG - Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1202705040 1_KI270713v1_random:16275-16297 TTGAATAATTAGAAATGGGAAGG + Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925645595 2:6032701-6032723 TTACAAAATCAGAAACAGGAGGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925876657 2:8317167-8317189 TTTAAGAATAAGAACAAGGAAGG + Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926772456 2:16390672-16390694 TTTAGAAATCAGGAAGAGGATGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
927960332 2:27237327-27237349 AGGAAGATTCAGAAATAGGAAGG - Intronic
928540400 2:32278596-32278618 TCAAAGAATGAGAAAAAGGAAGG + Intronic
928721419 2:34125700-34125722 TAGAAAAATCAGACAGAAGAAGG + Intergenic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
929324770 2:40595950-40595972 TTCAGGAATTAGAATGAGGAAGG + Intronic
929885834 2:45877405-45877427 TAGAAGAAAGAGTAAGAGGATGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
931533917 2:63250646-63250668 TAGAACAATGAGAAAGATGAGGG + Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933569377 2:83991601-83991623 TTGAAGAAAGAGAAAAAAGAGGG - Intergenic
933588738 2:84208160-84208182 TTGAAGAACCAGAAATGGGCTGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934968586 2:98744529-98744551 TTGAGGACTCAGACACAGGAAGG + Intergenic
935047544 2:99495603-99495625 TTTAAGAGTCAGCAAGAGGTAGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
936469238 2:112783846-112783868 TTCAGGAAGCACAAAGAGGAGGG - Intronic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
937009403 2:118548819-118548841 TTAAAAAATCAGCAACAGGATGG - Intergenic
937125146 2:119470342-119470364 TTTAATAATAAGAAATAGGATGG + Intronic
937144500 2:119631305-119631327 TTAAAAAATTAGAAAAAGGAGGG + Intronic
938189093 2:129258163-129258185 TTGAAGAATGAGGTAGAGAATGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940442438 2:153733941-153733963 TTGAAGAAATAAAAAGGGGATGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940614666 2:156035392-156035414 TTCAAAAATAAGACAGAGGAAGG - Intergenic
941947763 2:171118958-171118980 TAGAAGAAGTAGACAGAGGAAGG - Intronic
941997861 2:171617853-171617875 TTGTAGAATCAGCTACAGGATGG + Intergenic
942062387 2:172239749-172239771 TTGAGGAGTCAGAAAAAGGAAGG + Intergenic
942069318 2:172301183-172301205 TGGAAGAAAAAGAAAGAGAAGGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942909606 2:181227180-181227202 GAGAAGAATCAGAACGAGAAGGG + Intergenic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943784596 2:191863226-191863248 TTGAAGGATGAAAAAGAGAATGG - Intergenic
944325535 2:198399669-198399691 TTGAAGGATAACAGAGAGGAGGG + Intronic
944403902 2:199360709-199360731 TGTAATTATCAGAAAGAGGATGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
945086091 2:206134036-206134058 TTGAAGAATGACACAAAGGATGG - Intronic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947304907 2:228734776-228734798 ATGCAGAATCATAAAGAGTAGGG - Intergenic
947940721 2:234052726-234052748 TTGAATAATCAGAAAAGGCAGGG - Intronic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948477007 2:238226811-238226833 TTGGAGGATGAGACAGAGGAGGG - Intronic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1168936833 20:1672983-1673005 TTAGAGAATCAGAAAAATGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169313986 20:4572796-4572818 TTGAACAATCAGAATAAGCAAGG - Intergenic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171233395 20:23505582-23505604 TTGAAGAATGAGAAAGAGTGGGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171576971 20:26339867-26339889 TTGTAGAATCTGCAAGTGGATGG + Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173129952 20:40382891-40382913 CTGAAGAATCAGGCAGTGGAGGG - Intergenic
1173674511 20:44822128-44822150 TTCAAGAAACAAAACGAGGAGGG - Intergenic
1173859491 20:46273550-46273572 TTGATGCATCAGAAAGAGTAGGG - Intronic
1174379393 20:50146922-50146944 AACAAGAATCAGAAAGGGGAAGG - Intronic
1175287435 20:57846321-57846343 TTAGAGAATGAGAAAGAGTATGG - Intergenic
1175489686 20:59371502-59371524 TGGAAGAATGAGAAAGAGATGGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1180121195 21:45749503-45749525 TTGAAGAGTCAGGGAGAGGGAGG + Intronic
1180760297 22:18197208-18197230 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180770610 22:18381506-18381528 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180775372 22:18427488-18427510 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1180808441 22:18738543-18738565 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1180828553 22:18884464-18884486 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181071370 22:20343507-20343529 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1181194443 22:21172457-21172479 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1181214999 22:21320321-21320343 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1181682279 22:24503736-24503758 ATGAAGAGTCAGAGAGAGTATGG - Intronic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1181962772 22:26634891-26634913 GTGAAGATTCAGGAAGAGGCTGG - Intergenic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184970232 22:48014495-48014517 TTTAAGAATCAAAAGGAGGCCGG - Intergenic
1203232445 22_KI270731v1_random:122678-122700 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1203278647 22_KI270734v1_random:110453-110475 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
949602087 3:5611099-5611121 GTGATGGATGAGAAAGAGGAAGG - Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951169824 3:19528072-19528094 TGGAAGAATAAGAAGGAGAAGGG + Intronic
951287496 3:20832682-20832704 TTGAAGAAAGAGAAAGAAGTGGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951727987 3:25781596-25781618 TTCAAGATTCTGAAAGATGAGGG - Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
951984063 3:28598358-28598380 TTGAAGAATAACAGAGAGGGAGG + Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953701467 3:45199188-45199210 TGAAACAATCACAAAGAGGATGG + Intergenic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955545898 3:60029820-60029842 TTGTAGCACCAGAAAGAGGTTGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955988730 3:64602219-64602241 TTGAATGTTCAGAAAGAGAAAGG + Intronic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956914908 3:73860750-73860772 TGGAGGACTCAGAAAGAAGAAGG + Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957909297 3:86601692-86601714 TAGAACCATCAGAAAGAGCATGG - Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
959297963 3:104561422-104561444 TTAAAGAATCAGAAAGTGACTGG + Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961893516 3:130149260-130149282 TTCAAGGAACAGAAAGAGGGTGG + Intergenic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
962058307 3:131897894-131897916 TTAAAGAAAAAAAAAGAGGATGG + Intronic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
963706895 3:148698716-148698738 TTGAATAATCAAACTGAGGAAGG + Intronic
963961987 3:151319865-151319887 TTGAAAAATCAGTAAGATTACGG - Intronic
964577067 3:158183064-158183086 GTAAAGAATTAGAAAGGGGAAGG - Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965030417 3:163358442-163358464 TTGAAGAATTAGAGGGAGCAAGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965347735 3:167572963-167572985 AGGAAGAATTAGAAAGGGGAGGG - Intronic
965391054 3:168104304-168104326 TTGATGGAAGAGAAAGAGGATGG - Intergenic
965774363 3:172213049-172213071 TGGAAGAAAAAGAAAAAGGAAGG - Intronic
965784333 3:172320081-172320103 TGGAAGAATCTGAAAGAGGCCGG + Intronic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967330823 3:188287454-188287476 GTGAAGTGTCAGAAAGAGCAGGG - Intronic
968942072 4:3644091-3644113 TGGAAGAGGCAGGAAGAGGAAGG + Intergenic
970290186 4:14563493-14563515 TTGCTGATTCAGAAAAAGGAGGG + Intergenic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
973189740 4:47373244-47373266 TGGAAGAAGCAGAAAGAAAAAGG - Intronic
973337698 4:48972964-48972986 TACAAGAATAAGAAAAAGGAAGG - Intergenic
973545831 4:51981021-51981043 TTTAAAAATCTGAAAGTGGAAGG + Intergenic
973950784 4:56011306-56011328 TTGGAGAATAAGATAGAGTAGGG - Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974907371 4:68075143-68075165 TAGAAGAGTCAGGGAGAGGAAGG - Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976536800 4:86227085-86227107 TTGATGAATCAGAAATAAGAAGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977577907 4:98694251-98694273 GTGAGGAATCACAAAGATGAGGG + Intergenic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978420171 4:108523915-108523937 ATGAGGAATCAGCAAGAAGATGG - Intergenic
978640024 4:110859327-110859349 TTGAAGGATTAAAAAGAAGAGGG - Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978901273 4:113952435-113952457 TTGAAGACTCATAAAAAGCAAGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979199806 4:117963597-117963619 ATCAAGAATTAGAAAGAAGATGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980156280 4:129110825-129110847 GTGAAGGATAAGAAAAAGGAAGG - Intronic
980395671 4:132211733-132211755 ATGAAGTATAAGAAATAGGAAGG + Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
980853315 4:138410307-138410329 TTGAATAATCAGAATAATGATGG + Intergenic
981173720 4:141655246-141655268 ATGAAGGTTCATAAAGAGGATGG + Intronic
981309443 4:143282410-143282432 ATAAAGATTAAGAAAGAGGAGGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981806692 4:148724363-148724385 ATGAAGAATCAAAAACATGATGG - Intergenic
982244732 4:153340303-153340325 TTTCAGAATCAGAGAGAGGGTGG + Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983825655 4:172256143-172256165 TTGAAAAGTCAGGAAGATGATGG - Intronic
983889147 4:173013105-173013127 TTATAGAAACAGACAGAGGAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984211010 4:176848475-176848497 TTGAACAATGAGAAAGGAGAAGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984341453 4:178462088-178462110 TTGCAGAATGAGAAATAGGTGGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984699904 4:182812427-182812449 TGGAAGATTCAGAAGAAGGAAGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
985119184 4:186622774-186622796 TTCATGAAACAGAAAAAGGATGG - Intronic
985699636 5:1362791-1362813 TTGCTGAACTAGAAAGAGGATGG - Intergenic
985765041 5:1773072-1773094 TCGAAGAATCAGAAAGAAACAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987315704 5:16721212-16721234 TTTGTGAATCAGCAAGAGGAGGG - Intronic
987618744 5:20310955-20310977 TTGAAGACTCATAAAGTGGCTGG - Intronic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
989685121 5:44076532-44076554 TTGGAGGATCAGAAAAAGAATGG - Intergenic
989835777 5:45988472-45988494 TTGTAGAATCTGCAAAAGGATGG + Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990674953 5:58173490-58173512 TTGAAGATCAAGAAAGAGTAAGG - Intergenic
992018961 5:72603719-72603741 TTGAGGAATCCCAAAGAGCAGGG + Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992503938 5:77367107-77367129 TTGTAAACTTAGAAAGAGGAGGG + Intronic
992811177 5:80390187-80390209 TTTAAAAATCAGGGAGAGGAGGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993186242 5:84624473-84624495 TCAAAGCATCAGAAATAGGAAGG - Intergenic
993313885 5:86374779-86374801 TTGAAGTCTCTCAAAGAGGATGG - Intergenic
993640719 5:90402146-90402168 TTTAAGAATAAAAAAGAGGCTGG - Intronic
993768448 5:91893182-91893204 TTGAAGATTGAGAGAGGGGAAGG + Intergenic
993854819 5:93061080-93061102 ATCAAGAATTAGGAAGAGGAGGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
993926200 5:93869411-93869433 TTGAAGAATTAGGAAGAGCTTGG + Intronic
994157947 5:96524348-96524370 GTGAAGTATCTGAAAGTGGAAGG + Intergenic
994217500 5:97154754-97154776 TTGAGCAATCAGAAAAAAGAAGG - Intronic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994415607 5:99466633-99466655 TTGAAAACTCAGAAAGGAGAAGG + Intergenic
994527745 5:100927805-100927827 TTTAATCATCAGAAACAGGATGG - Intergenic
994607125 5:101982179-101982201 TGTAAGGATCAGAAAGAGGGTGG + Intergenic
995245086 5:109926011-109926033 TGGAAGAATAAAAAAGAGGGAGG - Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
996003912 5:118398255-118398277 TTAAAGTATAATAAAGAGGATGG - Intergenic
996471645 5:123867882-123867904 TTTCAAAATTAGAAAGAGGAAGG + Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996563650 5:124857319-124857341 TTGAAGAACAACAAAGAGGCCGG + Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997750104 5:136336113-136336135 TTGAAGAATGAGTAAGAGTTTGG - Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998475663 5:142419347-142419369 TTGAAAAATCAGAAAAAGAGAGG + Intergenic
998921674 5:147075018-147075040 TTGCAGTATCAGAAAGAAAATGG + Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000048549 5:157542018-157542040 TGGAAGAATTAGATAGAGAAAGG - Intronic
1000316404 5:160096614-160096636 TTTATAAATCAGTAAGAGGAAGG - Intronic
1000992205 5:167922814-167922836 CTGATGGATCTGAAAGAGGAGGG - Intronic
1001068424 5:168559882-168559904 TTGATGAATCAGGCAGGGGACGG - Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003038378 6:2664879-2664901 TTTAAAAATCAGGGAGAGGAGGG - Exonic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003694080 6:8384971-8384993 TTGAAAAAGCAGAAAAGGGAAGG + Intergenic
1003976952 6:11353504-11353526 TTGAAGGTTCAGAAAGAGCGTGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006857909 6:37148723-37148745 TGGAAGAATCAGCTAGTGGAAGG - Intergenic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1009339674 6:62538650-62538672 TTGAAGAATCACATATAGGCCGG + Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1010499136 6:76573294-76573316 TTGAATAATCACAAAGAGCAGGG + Intergenic
1010663944 6:78604293-78604315 TTAGGGAATCAGATAGAGGAAGG - Intergenic
1010835614 6:80584403-80584425 CTGAAGATTCCTAAAGAGGAGGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1013006223 6:106076332-106076354 TTGAAGAATCAGCAAAATAATGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013548257 6:111181610-111181632 TTGAAGATTCAGAAATACAATGG + Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1014295186 6:119609106-119609128 GTGAAGGGTGAGAAAGAGGATGG + Intergenic
1014707168 6:124761863-124761885 TGGAAAAAACAGAAATAGGAAGG + Intronic
1014917657 6:127171712-127171734 TTTAGCAATCAAAAAGAGGAAGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1017049764 6:150379406-150379428 TTGAGGAATAAGAAAGAGGCTGG - Intronic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017385729 6:153880633-153880655 TAGAAAAATCAGGAAAAGGAAGG + Intergenic
1017515816 6:155154867-155154889 TTTTAAAATCATAAAGAGGACGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018385619 6:163300344-163300366 CTGAAGAGTCTGGAAGAGGACGG + Intronic
1018596091 6:165482212-165482234 TTAAAGTATCAGAAAGATTATGG - Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1020589542 7:10117342-10117364 TTGAAAAAAAAGAAAGAAGAAGG - Intergenic
1020805179 7:12781112-12781134 TTCTAGAATCAGAAAGTGCATGG + Intergenic
1021807490 7:24371692-24371714 CAGAAGTATCAGAAAGATGATGG - Intergenic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022588550 7:31639189-31639211 CTGAAAAATCCCAAAGAGGAGGG - Intronic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1023218482 7:37892904-37892926 TAAAAGAAAGAGAAAGAGGAAGG - Intronic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1024497504 7:50065201-50065223 TAGAGGAATTAGAAAGAGGAAGG + Intronic
1025207146 7:57000450-57000472 ATGAAGAATGGGAAAGGGGAGGG - Intergenic
1025664790 7:63576440-63576462 ATGAAGAATGGGAAAGGGGAGGG + Intergenic
1026446223 7:70487181-70487203 TAGATGAGTCAGAAAAAGGAGGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028960343 7:96741792-96741814 TTCAAGGATCAGGAAGAGAAAGG + Intergenic
1029835738 7:103307854-103307876 TTAAAGAATACGGAAGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030169602 7:106588247-106588269 TAGAAGTTTGAGAAAGAGGATGG - Intergenic
1030333931 7:108303331-108303353 ATGAAGAATGAGGAAGAGCAAGG - Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1030954743 7:115838092-115838114 TTGAATAATGAGACACAGGAAGG - Intergenic
1031291974 7:119949467-119949489 GTGAAGAAACATAAAGAGGGTGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1033234246 7:139625622-139625644 GTGAAGGATGAGGAAGAGGATGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1036100728 8:5781098-5781120 TTGAAGAAATCGAAAGAGAATGG - Intergenic
1036167779 8:6453138-6453160 TGGGAGAGTCAGGAAGAGGAGGG + Intronic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037009759 8:13826465-13826487 TAAAAGAATCACAAAGAAGAAGG + Intergenic
1037219779 8:16504607-16504629 TTGAAGAAAAGGAAAGGGGAAGG + Intronic
1038118636 8:24586576-24586598 TAGAACAATAAGATAGAGGAAGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1039309140 8:36297019-36297041 TGGAAGAAACAGAAAGATGTGGG + Intergenic
1039789854 8:40866637-40866659 TTGATGAATAATTAAGAGGAGGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041524774 8:58792936-58792958 TGGAAGAAACAGAAAAAGAAGGG + Intergenic
1041880302 8:62741963-62741985 TTGTAGAATAAGGAAGAAGAGGG - Intronic
1042313233 8:67399163-67399185 TTGAAGATTGAGAAAGAGCTGGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042813689 8:72854421-72854443 TTGAAAAATCTGAAAAAGTATGG - Intronic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044772483 8:95651327-95651349 TTGAAGAATAGGAAAAAGAAGGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045718666 8:105079655-105079677 TGGAAGAAAGAGAAAGAGGGAGG + Intronic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045976083 8:108131774-108131796 TTCAAGTCTCAGATAGAGGAGGG - Intergenic
1045988978 8:108283944-108283966 TTGATGAATATGAAGGAGGACGG - Intronic
1046006102 8:108487325-108487347 TTAAAGAATCATAAAGAGTAGGG + Intergenic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046776541 8:118169730-118169752 TTGAAAAATAAAAAAGATGAAGG + Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047292731 8:123543761-123543783 TTTAAGGAACAGAAAGCGGAAGG - Intergenic
1047833196 8:128658360-128658382 TGGAGGAATCAGTAAGAAGAAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048154922 8:131937497-131937519 TAGAAGAATATGAAATAGGAAGG - Intronic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049713664 8:144079113-144079135 TTGAAGAGCCGCAAAGAGGAAGG - Intronic
1049993630 9:1013420-1013442 TTGAAGTAAAAGAAAGAGGTGGG + Intergenic
1050193549 9:3056120-3056142 TTGAAAAGTCAGTAAGAGGCTGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051311865 9:15783596-15783618 GTGAAGTATAAAAAAGAGGAAGG - Intronic
1052489112 9:29140567-29140589 TGGAAGTCTCAGAAAGAGAAGGG + Intergenic
1052521668 9:29555721-29555743 TAAAAGATTAAGAAAGAGGAAGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1055189959 9:73506603-73506625 TTGAGGAGTCAGAAAGAGATGGG - Intergenic
1055410318 9:76021935-76021957 TCAAAGAAAGAGAAAGAGGATGG - Intronic
1056439115 9:86602860-86602882 TCCAAGAATCAGACAGAGGAAGG + Intergenic
1056479064 9:86982512-86982534 TTGAAGATCGAGAAAGGGGAAGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058151771 9:101471663-101471685 TTAAAATATCAGAAAGATGAAGG + Intergenic
1058243106 9:102591848-102591870 TTGTATAATGAGAAATAGGAGGG - Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1059056329 9:110984962-110984984 TTAAAGAATCAAAAAGAAAAAGG + Intronic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059218410 9:112589238-112589260 TGGGAGAATCAGAAAAATGAGGG - Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059599890 9:115765578-115765600 TTACAGAAAAAGAAAGAGGATGG - Intergenic
1059638106 9:116190429-116190451 TTCAAGATTCAGAAAGATGAAGG + Intronic
1059814958 9:117901804-117901826 TGGCAGATTCAGAAAAAGGAAGG + Intergenic
1059883838 9:118722257-118722279 TTGATGATTCAGAATCAGGAAGG + Intergenic
1059947136 9:119421096-119421118 TTTATTAATGAGAAAGAGGAAGG + Intergenic
1059984983 9:119812998-119813020 TTGAGGGATAAGCAAGAGGAAGG + Intergenic
1060163004 9:121383943-121383965 TGAAAGGATCAGAAAGAGGAAGG + Intergenic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1062228151 9:135465527-135465549 TTGAAGAATCAGCGACAGGACGG + Intergenic
1062298894 9:135852752-135852774 TTGAAGAATAAGAATGTGCAGGG - Intronic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1185498141 X:574756-574778 TGGCAGAATCAGAAAGGTGACGG + Intergenic
1185539213 X:888841-888863 TTGAGGAGTCAAACAGAGGAAGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186601422 X:11041742-11041764 TGGAAGGATGAGAAAGAGGGAGG - Intergenic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187966668 X:24618917-24618939 TTAAAGTATCAGAAAGGGGCCGG - Intronic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188346549 X:29073615-29073637 TTGAAGAATCAGACAGTATATGG - Intronic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1193878324 X:86891362-86891384 ATCACAAATCAGAAAGAGGAAGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194539008 X:95146943-95146965 TTGAAGAATGACAAAGATGTTGG + Intergenic
1194549793 X:95282805-95282827 ATGAAGAATAATACAGAGGATGG - Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195345161 X:103942558-103942580 TTGAGGAATAAGAATGAGGTGGG - Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196038837 X:111178397-111178419 TTGAAGAAAAAGAAAGAGACAGG + Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197664901 X:129212922-129212944 TTGCAGAATCAAAAAGAATAAGG - Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic