ID: 1080684271

View in Genome Browser
Species Human (GRCh38)
Location 11:34502514-34502536
Sequence GCTAATCCTCCCACCTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080684263_1080684271 27 Left 1080684263 11:34502464-34502486 CCTCTCTGGGTGGCAACGTCCTT 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1080684271 11:34502514-34502536 GCTAATCCTCCCACCTGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1080684264_1080684271 8 Left 1080684264 11:34502483-34502505 CCTTGTTGATAAAAGACAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 270
Right 1080684271 11:34502514-34502536 GCTAATCCTCCCACCTGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080684271 Original CRISPR GCTAATCCTCCCACCTGTGG AGG Intronic
900261246 1:1730920-1730942 GCCCAGCCTCCTACCTGTGGTGG - Intronic
901184042 1:7360741-7360763 GCAAATCCTTGCACCTGTGCAGG - Intronic
901765360 1:11496641-11496663 GCCCATCCTACCAGCTGTGGAGG + Intronic
902888787 1:19426418-19426440 GACACTCCTCCCACTTGTGGTGG + Intronic
904288341 1:29468084-29468106 GCTTATCCCCCAACCTGTGTGGG - Intergenic
908234676 1:62137901-62137923 GAAAATCCCCCCACCTGAGGAGG - Intronic
920131725 1:203737145-203737167 GCTTTTCCTCTCACCTGTTGGGG - Intronic
1068689954 10:59905517-59905539 GCTAATGCTCCCACCTCTGTTGG - Intronic
1068848474 10:61707898-61707920 GGTAATCCAACTACCTGTGGTGG - Intronic
1069686751 10:70323767-70323789 GCTTCTCCTCCCACCTGTGAAGG + Intronic
1076917268 10:133430529-133430551 CCTATGCCTCCCACCTGGGGTGG - Intergenic
1076937365 10:133575288-133575310 CCTATGCCTCCCACCTGGGGTGG - Intergenic
1080684271 11:34502514-34502536 GCTAATCCTCCCACCTGTGGAGG + Intronic
1082971967 11:59032031-59032053 TATCATCCTCTCACCTGTGGTGG + Intronic
1082976010 11:59072241-59072263 TATCATCCTCTCACCTGTGGTGG + Intergenic
1085156549 11:74300541-74300563 AGTGATCCTCCCACCTGGGGGGG - Intronic
1085794150 11:79521483-79521505 ACTAATCATCCCACATCTGGAGG + Intergenic
1090765209 11:129870466-129870488 GCTATCCCTCCCCACTGTGGTGG + Intronic
1091630412 12:2155751-2155773 GCTCATCCTCCCACCTCCGGTGG - Intronic
1093542687 12:20305674-20305696 GCTAAGACTCCCCACTGTGGAGG + Intergenic
1093724957 12:22494527-22494549 GCTGATCCTCCTCCCTGTGGAGG - Intronic
1093966639 12:25334046-25334068 GGTAATCCTCCAAACTGTGAAGG + Intergenic
1095392651 12:41727220-41727242 GCTAGGGCTCCCACCTGTGAAGG - Intergenic
1100218337 12:92477092-92477114 GCGAGGCCTCCCATCTGTGGAGG + Intergenic
1103202631 12:119100817-119100839 CCTAAACCTCCCTCCTATGGGGG - Intronic
1113923247 13:113926350-113926372 GTTAATCCCTTCACCTGTGGTGG - Intergenic
1118347149 14:64948602-64948624 GCTCCTCCTCCCACCTCTGCTGG + Intronic
1132684437 16:1156423-1156445 GCCAATCCCCCCACCTGTCCAGG - Intronic
1132723749 16:1330014-1330036 GCGACTCCTCCCAGCTCTGGGGG - Intergenic
1134793447 16:17012356-17012378 GCTTATCCTCCCAGTTGAGGAGG + Intergenic
1135563159 16:23492325-23492347 CCACATCCCCCCACCTGTGGAGG + Intronic
1139528266 16:67529349-67529371 GCTAATCCTCCTAGCTCTAGGGG + Intronic
1142004056 16:87680659-87680681 CCTATGGCTCCCACCTGTGGAGG - Intronic
1142605466 17:1078763-1078785 GCGGACCCTCCCACCTCTGGGGG - Intronic
1142918407 17:3162880-3162902 GGTAAGCCTCCCAGCTGGGGTGG - Intergenic
1147207027 17:38844719-38844741 TCTAATCCTCCCAGCTTGGGAGG - Intergenic
1148871188 17:50659541-50659563 GCTAGTTCTCCCAGCTCTGGTGG + Intronic
1151394408 17:73812723-73812745 GCTAATCCTCCTACCAGTCTAGG + Intergenic
1151963092 17:77417821-77417843 GCAAATCCTCCTACCGGAGGGGG + Intronic
1152826068 17:82465652-82465674 GGTGATCCTCCCACCTCTGGAGG + Intronic
1153054363 18:931257-931279 TGTAATCCTACCACCTGGGGAGG - Intergenic
1155601350 18:27552105-27552127 GGTAATCCTCCCACCTCAGCCGG + Intergenic
1156384383 18:36592662-36592684 GCAAATCCACCCACCAGTGCTGG - Intronic
1156786495 18:40921509-40921531 GCAAACCCTCCCACCACTGGTGG - Intergenic
1162298794 19:9831892-9831914 ACCACTCCTCCCACCAGTGGTGG + Intergenic
1164063387 19:21694191-21694213 CCTCATCCTCCCTGCTGTGGAGG - Intergenic
1166132532 19:40754806-40754828 GAATATCCTCCCAGCTGTGGAGG + Intronic
1166210583 19:41304253-41304275 ACTCATTCTCTCACCTGTGGAGG - Exonic
1168488621 19:56787511-56787533 GGTGATCCTCCCACCTTGGGAGG + Intronic
926810651 2:16752674-16752696 GCTACTCATCCCAGCTGGGGGGG - Intergenic
927787289 2:25982559-25982581 GCTAAGCCTCCCGACTGGGGTGG + Intronic
931789772 2:65654508-65654530 GCAAAACCTCCCAGCTGTGGTGG + Intergenic
934667128 2:96180005-96180027 GGCAATCCTCCCACCTCTGCTGG - Intergenic
1170372781 20:15667690-15667712 ATTAATCCTCCCACCTGTTACGG + Intronic
1178391754 21:32204653-32204675 GGTGATCCACCCACCTGAGGTGG - Intergenic
1180639795 22:17289009-17289031 GCTAATCTTGCCACCTGTGCCGG - Intergenic
1183005736 22:34900132-34900154 TCTCATCCTCCTACCTTTGGGGG + Intergenic
1183623228 22:38986833-38986855 GCTATTCCTCCCTCCAATGGTGG + Intronic
1183633477 22:39047172-39047194 GCTATTCCTCCCTCCAATGGTGG + Intronic
1184020314 22:41816632-41816654 AATAATCCTGCCACCTGGGGAGG - Intronic
1184186051 22:42866230-42866252 GCACATCCTCCCAGGTGTGGTGG + Intronic
1185026603 22:48417692-48417714 GCTCAGCCTCCCACCCCTGGAGG - Intergenic
1185326285 22:50227354-50227376 CCTGATCCTCCCACTTCTGGGGG + Intronic
949877429 3:8635352-8635374 GATATTCTTCCCACCTTTGGAGG - Exonic
953663175 3:44905797-44905819 CCTGCTCCTCCCACCTCTGGGGG - Intronic
957117003 3:76039113-76039135 GCCACTTCCCCCACCTGTGGAGG - Intronic
958673444 3:97234172-97234194 GCTAATCCTTCCAATTGTTGGGG + Intronic
958799216 3:98736468-98736490 AATAACCCTCCCACCTCTGGAGG - Intronic
961259627 3:125591025-125591047 TTTAATCCTCCCAACTCTGGAGG - Intronic
961625797 3:128262697-128262719 GATAAGCCTCCCATCTTTGGTGG - Intronic
961780737 3:129318828-129318850 GCCACTCCTCCCCCCTGCGGTGG - Intergenic
964967722 3:162518362-162518384 GCTAGTGCTCAGACCTGTGGAGG - Intergenic
968932738 4:3590605-3590627 GCAACTCCTGCCCCCTGTGGGGG + Intronic
970656280 4:18234030-18234052 GCTCCTCCTACCACCTGTGATGG - Intergenic
975311568 4:72909661-72909683 GAGAATCCTCCTACCTGTAGGGG - Intergenic
983171166 4:164538218-164538240 TCAAATCCTTTCACCTGTGGTGG + Intergenic
990330334 5:54719431-54719453 GCTGCTCCTCCCTCCTGTGGAGG - Intergenic
996435278 5:123427394-123427416 GCTCATCATTCCTCCTGTGGTGG - Intergenic
1002839579 6:894272-894294 CTTAATTCTCCCACGTGTGGTGG + Intergenic
1013079348 6:106799078-106799100 GCTAATCCTCACTCCTTTGAAGG - Intergenic
1017035652 6:150264711-150264733 GCTACTCCTCAGTCCTGTGGTGG - Intergenic
1022359136 7:29642438-29642460 CCTCATCCTCCCCACTGTGGAGG - Intergenic
1033664212 7:143425321-143425343 GCTAATCCTTGTAACTGTGGCGG + Intergenic
1033924331 7:146439084-146439106 GATACTCCATCCACCTGTGGCGG - Intronic
1034820604 7:154213081-154213103 TGGCATCCTCCCACCTGTGGAGG - Intronic
1038067153 8:23974999-23975021 GCTAAACCTTACATCTGTGGTGG - Intergenic
1042193023 8:66207153-66207175 GCTTATCCTCTCAGCTGTGATGG + Intergenic
1042671226 8:71265571-71265593 GGTAATCCTCCCACAGGAGGGGG + Intronic
1048164135 8:132047163-132047185 GTTATTCCTCTCACCAGTGGTGG - Intronic
1048976711 8:139677243-139677265 GCTTCTCCTATCACCTGTGGGGG + Intronic
1049343831 8:142128041-142128063 GCTGCTCCTCCTTCCTGTGGGGG + Intergenic
1049747490 8:144269132-144269154 GCTAAACCCACCTCCTGTGGTGG - Intronic
1054457387 9:65441290-65441312 GCAACTCCTGCCCCCTGTGGGGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1059996300 9:119913560-119913582 ACTATTCTTCCTACCTGTGGGGG - Intergenic
1061429056 9:130519629-130519651 ACTAATCTTCCCGGCTGTGGAGG + Intergenic
1062366653 9:136212767-136212789 TCTAATCCTCCCACAGGTAGAGG - Intronic
1187831522 X:23387361-23387383 GCTAATCCTCCCATCACTGAGGG - Intronic
1189237440 X:39498096-39498118 GCTAGGCCTCCCACCTGCGGGGG - Intergenic
1197838083 X:130716452-130716474 CCTGATCCCCCCATCTGTGGTGG + Intronic
1199998097 X:153039510-153039532 CCTTATCCTCCCTCCTGGGGAGG + Intergenic