ID: 1080688716

View in Genome Browser
Species Human (GRCh38)
Location 11:34537725-34537747
Sequence CAGAGGTCACAGAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080688716_1080688723 5 Left 1080688716 11:34537725-34537747 CCGTCTTCCCTCTGTGACCTCTG No data
Right 1080688723 11:34537753-34537775 TCTCTGGCTGCCCTGGCTGGAGG No data
1080688716_1080688722 2 Left 1080688716 11:34537725-34537747 CCGTCTTCCCTCTGTGACCTCTG No data
Right 1080688722 11:34537750-34537772 GTTTCTCTGGCTGCCCTGGCTGG No data
1080688716_1080688721 -2 Left 1080688716 11:34537725-34537747 CCGTCTTCCCTCTGTGACCTCTG No data
Right 1080688721 11:34537746-34537768 TGCAGTTTCTCTGGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080688716 Original CRISPR CAGAGGTCACAGAGGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr