ID: 1080689798

View in Genome Browser
Species Human (GRCh38)
Location 11:34546875-34546897
Sequence GCACCCTTCTCAGCTTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080689798_1080689802 1 Left 1080689798 11:34546875-34546897 CCTGTTTAAGCTGAGAAGGGTGC No data
Right 1080689802 11:34546899-34546921 GGAGGCACCTGTGTGATGTTGGG No data
1080689798_1080689804 8 Left 1080689798 11:34546875-34546897 CCTGTTTAAGCTGAGAAGGGTGC No data
Right 1080689804 11:34546906-34546928 CCTGTGTGATGTTGGGTCAGTGG No data
1080689798_1080689805 11 Left 1080689798 11:34546875-34546897 CCTGTTTAAGCTGAGAAGGGTGC No data
Right 1080689805 11:34546909-34546931 GTGTGATGTTGGGTCAGTGGAGG No data
1080689798_1080689801 0 Left 1080689798 11:34546875-34546897 CCTGTTTAAGCTGAGAAGGGTGC No data
Right 1080689801 11:34546898-34546920 TGGAGGCACCTGTGTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080689798 Original CRISPR GCACCCTTCTCAGCTTAAAC AGG (reversed) Intergenic
No off target data available for this crispr