ID: 1080693722

View in Genome Browser
Species Human (GRCh38)
Location 11:34582622-34582644
Sequence TGGAGAAATGCTAATAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080693722_1080693726 3 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693726 11:34582648-34582670 CTTTTTATAAGTCTAGACTGGGG No data
1080693722_1080693724 1 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693724 11:34582646-34582668 CACTTTTTATAAGTCTAGACTGG No data
1080693722_1080693727 18 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693727 11:34582663-34582685 GACTGGGGATTATTAAACTGTGG No data
1080693722_1080693730 26 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693730 11:34582671-34582693 ATTATTAAACTGTGGTCTAGGGG No data
1080693722_1080693729 25 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693729 11:34582670-34582692 GATTATTAAACTGTGGTCTAGGG No data
1080693722_1080693725 2 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693725 11:34582647-34582669 ACTTTTTATAAGTCTAGACTGGG No data
1080693722_1080693728 24 Left 1080693722 11:34582622-34582644 CCTGCATTATTAGCATTTCTCCA No data
Right 1080693728 11:34582669-34582691 GGATTATTAAACTGTGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080693722 Original CRISPR TGGAGAAATGCTAATAATGC AGG (reversed) Intergenic
No off target data available for this crispr