ID: 1080700497

View in Genome Browser
Species Human (GRCh38)
Location 11:34640171-34640193
Sequence CAGGGTCACCCACAGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080700497 Original CRISPR CAGGGTCACCCACAGTAAGC AGG Intronic
900309373 1:2025926-2025948 CAAGGTCGCCGACAGGAAGCCGG + Intronic
900322955 1:2094039-2094061 GAGGGTCACCCAAAGTGGGCTGG - Intronic
901150756 1:7099669-7099691 CAGAGTTACCAACAGAAAGCTGG - Intronic
901427533 1:9191962-9191984 AAGGGTCACCCACTGAAAGGTGG + Intergenic
902833056 1:19029961-19029983 CAGGATCTCCCACAGTCACCTGG - Intergenic
903227175 1:21900343-21900365 CAGGGTGACCCCCAGTGGGCAGG + Intronic
904259264 1:29279134-29279156 CAGGGTCCCCCACTGTAATAGGG - Intronic
905105004 1:35558870-35558892 CAAGGTCACCTCCAGAAAGCGGG - Intronic
905276134 1:36819414-36819436 CAGGGTCAGCCGCAGCCAGCAGG + Intronic
905559844 1:38917933-38917955 AAGGCTCACCCACAGTATGGTGG - Intronic
907868797 1:58424279-58424301 GAGGCCCACCCACAGTAAGGAGG + Intronic
913665461 1:121044130-121044152 CAGGGCCAGCTACAGAAAGCGGG - Intergenic
914016856 1:143827399-143827421 CAGGGCCAGCTACAGAAAGCGGG - Intergenic
914160930 1:145133612-145133634 CAGGGCCAGCTACAGAAAGCGGG + Intergenic
914655466 1:149735940-149735962 CAGGGCCAGCTACAGAAAGCGGG - Intergenic
915315090 1:155023967-155023989 AAGGGTCACAGACACTAAGCAGG + Intronic
916507423 1:165440732-165440754 CAGGGGCTCCCAGAGGAAGCTGG - Intronic
1063142415 10:3267343-3267365 CAGTGTCACCCACAGGACTCAGG - Intergenic
1066046144 10:31597193-31597215 CAGGGCCACCCACATTAGGGAGG + Intergenic
1067673350 10:48346630-48346652 CAGGCTCTCCCACAGTTATCCGG + Intronic
1069674197 10:70235656-70235678 CAGGGTCACCCACAGCAAAGGGG - Intergenic
1072007711 10:91270419-91270441 CAGGGTCAACAAGAGTAAGCTGG - Intronic
1072801879 10:98397781-98397803 AAGTGTCACCCACAGAAAACTGG + Intronic
1075427698 10:122354608-122354630 CAGTGTCACCCACTGTGTGCAGG - Intergenic
1076419632 10:130321746-130321768 CAGGCTCACCCGCAGTTATCCGG + Intergenic
1076526074 10:131113000-131113022 CACGCTCACCCACAGTTACCCGG - Intronic
1076616548 10:131759011-131759033 CAGGGTCACCTTCAGTGCGCAGG + Intergenic
1076870003 10:133188528-133188550 CAGGGACACCCACTGTGGGCAGG - Exonic
1076891165 10:133284221-133284243 CAGGGACACCCCCAGCCAGCTGG + Intronic
1077137588 11:1008911-1008933 CAGTGTCACCCACAGACAGGAGG - Intronic
1077388335 11:2286367-2286389 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1078271267 11:9797177-9797199 CTGGGTCAGCCAAAGTGAGCAGG + Intronic
1079051051 11:17159970-17159992 GAGGCTCACTCACATTAAGCAGG + Intronic
1079249634 11:18777918-18777940 CAGGGTCTCGCCCTGTAAGCTGG - Intronic
1080700497 11:34640171-34640193 CAGGGTCACCCACAGTAAGCAGG + Intronic
1082954145 11:58850816-58850838 CAGGCCCACCCACAGTTATCTGG + Intronic
1083719446 11:64597196-64597218 CAGGGTCACCCACAATGATCTGG + Intronic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1086240714 11:84686919-84686941 CAGAATCAACCACAGGAAGCTGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089316631 11:117595724-117595746 CAGGGTGACCCACACAAAGGTGG - Intronic
1089904820 11:122027804-122027826 CAGGGTCCCCCCCAGCAAGAAGG - Intergenic
1091396736 12:157810-157832 CCTGGTCACCCATAGCAAGCTGG + Intronic
1091525799 12:1299600-1299622 CAGAGTAAACCACAGTAAGTAGG + Intronic
1096233477 12:49910411-49910433 CCAGCTCACCCACAGTAAGAAGG + Intergenic
1096575826 12:52552294-52552316 CAGTCTCGCCCAGAGTAAGCAGG - Intronic
1101901283 12:108792759-108792781 CAGGGTCATCCACAGGCTGCTGG + Exonic
1102732631 12:115126364-115126386 CAGAGTCCCCCACAGCAAGAAGG - Intergenic
1105287122 13:19013533-19013555 CAGGCCCACCCACAGTTATCCGG + Intergenic
1105949636 13:25218021-25218043 CAGGGTATCCCACAATAAGATGG + Intergenic
1111060803 13:83016286-83016308 GAGGGTCACACACATTATGCAGG + Intergenic
1113648346 13:112014876-112014898 CAGCGTTACTCACAGTAGGCAGG - Intergenic
1114658119 14:24328313-24328335 CAGGCTCACCCACAGTTATCCGG + Intronic
1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG + Intergenic
1121216858 14:92255070-92255092 CGGGGTCCCCCAGAATAAGCTGG - Intergenic
1124120285 15:26883062-26883084 CAGGGTCACCCTCTGCAACCGGG - Intronic
1124155369 15:27220425-27220447 CAGGGTAAGCCACAGTATGCGGG + Intronic
1124497718 15:30196402-30196424 CATGGTCGCCCTCAGTCAGCCGG + Intergenic
1124687677 15:31796452-31796474 GAGGCTCACCCACATTAAGAAGG + Intronic
1124745868 15:32342289-32342311 CATGGTCGCCCTCAGTCAGCCGG - Intergenic
1125200523 15:37097925-37097947 CACACTCACACACAGTAAGCTGG + Intronic
1125745805 15:41996513-41996535 TAGGGTCAGCCTCAGAAAGCAGG + Intronic
1127520482 15:59738798-59738820 CAGGGTCACCCACACCTAGCTGG - Intergenic
1127781103 15:62316868-62316890 AAGGTTCACTCACACTAAGCTGG + Intergenic
1128722760 15:69963892-69963914 CAGGCTCAACCACAGTCACCTGG + Intergenic
1129378160 15:75147339-75147361 CAGGGTGAGCCACAGTACCCAGG + Intergenic
1130905856 15:88240530-88240552 CAGCCTCCTCCACAGTAAGCAGG - Intronic
1131913103 15:97230790-97230812 GTGGGCCACCCACAGAAAGCAGG - Intergenic
1132186748 15:99807135-99807157 CATGGTCGCCCTCAGTCAGCGGG + Intergenic
1132428939 15:101745576-101745598 CATGGTCGCCCTCAGTCAGCGGG - Intronic
1136122732 16:28150085-28150107 CTGGTTTACCCACAGTAAGCTGG + Intronic
1137056936 16:35750478-35750500 AAGGGTCAGCCACAGTCAGGGGG - Intergenic
1140242152 16:73212809-73212831 CAGGGTCACCCTCTATCAGCTGG + Intergenic
1140950119 16:79808837-79808859 CAGAGTCACCATCAGTGAGCTGG - Intergenic
1141146734 16:81536214-81536236 CCAGGTCACCCTCAGCAAGCTGG - Intronic
1142251941 16:88996048-88996070 CACGGTCATCCACAGAGAGCTGG + Intergenic
1142323086 16:89397454-89397476 CAGGGGGACCCACAGGAAGCAGG + Intronic
1142389806 16:89791839-89791861 GAGGCTCACCCACAGTCAGCTGG + Intronic
1142389994 16:89793081-89793103 CAGGCTCACCCACAGTTATCCGG - Intronic
1146073534 17:29706507-29706529 CAGAGTGACCCACAGTAGGGTGG - Intronic
1146356098 17:32135538-32135560 CAGGCTCACCCGCAGTTATCGGG - Intergenic
1148087176 17:45001229-45001251 CAGGGTCACCCGCAGGCAGCTGG + Intergenic
1148087666 17:45004188-45004210 CAGGGTCACACACAGCCAGGAGG - Intergenic
1148212911 17:45818996-45819018 CTGGGTCACCCAGAGGGAGCAGG - Intronic
1151172967 17:72263583-72263605 CAGGGTCTCACAAAGGAAGCAGG + Intergenic
1155084570 18:22445405-22445427 AATGGCCACTCACAGTAAGCTGG - Intergenic
1155596639 18:27495505-27495527 CAGGGTTAACCACAGCAAGCAGG + Intergenic
1155745335 18:29350031-29350053 CAGGTTAACCCAAAGTAAGCAGG + Intergenic
1159779456 18:72644295-72644317 CAGGCTCAATCACACTAAGCTGG + Intergenic
1160796488 19:948064-948086 CAGGGTCACCCACACCCAGCAGG - Intronic
1162478337 19:10914137-10914159 CCGGGCCACCGACAGTAAGCAGG - Intronic
1163013673 19:14440897-14440919 CAGCGTCCCCCACATTAAGGGGG - Intronic
1163519752 19:17784868-17784890 CAGGCTCCCCCACAGGCAGCAGG - Exonic
1163786452 19:19277273-19277295 CAGGGTCCCACACAGGAAGGAGG + Intronic
1164083496 19:21880735-21880757 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1164389087 19:27802312-27802334 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1164941186 19:32253203-32253225 CAGGGTCACCCACAGGGACCTGG + Intergenic
1165753935 19:38280714-38280736 CAGGGTGACCCACAGTATCATGG - Intronic
1167016147 19:46842333-46842355 CAGTGACAACCACAGTAGGCAGG - Intronic
1168480920 19:56719008-56719030 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1168680328 19:58310735-58310757 CAGGCTCGCCCACAGTTATCCGG - Intronic
925919094 2:8627260-8627282 CTGGGTCACTCACTGCAAGCTGG - Intergenic
928134588 2:28678678-28678700 CACGGTCACCTACAGCAAGAGGG + Intergenic
931270047 2:60693570-60693592 CAGGAGCACCCACAGGAGGCAGG + Intergenic
932437915 2:71713782-71713804 TAGGGTCACCTACAGCAATCAGG - Intergenic
933797986 2:85936641-85936663 CAGGGTCACTCAGAGCACGCGGG + Intergenic
935881853 2:107573242-107573264 CAGGCTCACCCGCAGTTATCTGG + Intergenic
936251377 2:110870704-110870726 CAGAGTCACCCACAGGTGGCAGG - Intronic
937306165 2:120872335-120872357 CAGGGGACCCCACTGTAAGCTGG - Intronic
941928211 2:170916459-170916481 CAGGCTCGCCCACAGTTATCTGG + Intergenic
941964643 2:171288960-171288982 CAGGCACACCCATCGTAAGCGGG + Intergenic
942884439 2:180906015-180906037 CAGGGTCATCCCCAGGAAGTTGG - Intergenic
943259138 2:185635618-185635640 CAAGGTTACAGACAGTAAGCAGG + Intergenic
943649503 2:190441773-190441795 CAGGGCCACCCACAGTGGGTGGG - Intronic
944674061 2:202020392-202020414 CTGGGAGACCCACAGAAAGCTGG - Intergenic
948783350 2:240338394-240338416 CAGGGTCACCCACAGCTCACTGG + Intergenic
949046739 2:241875772-241875794 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1172483826 20:35287074-35287096 CAGGGGCACCCCCAGTACCCAGG + Exonic
1172693368 20:36805352-36805374 CAGGGTCACACACGGTGAGCTGG - Intronic
1172942725 20:38665668-38665690 CAGGTTGAACCACAGTAAACTGG - Intergenic
1173597840 20:44271287-44271309 GAGGTTCTCCCACACTAAGCGGG + Intronic
1174766184 20:53255900-53255922 CAGGGTCCCCCCCATGAAGCTGG + Exonic
1175859025 20:62139825-62139847 CCGGGTCCTCCACAGTCAGCCGG + Exonic
1178493218 21:33067511-33067533 CAGGGACACCCACAGGAAAGAGG + Intergenic
1181837836 22:25625628-25625650 CAGGCTCGCCCACAGTTATCCGG + Intronic
1184351636 22:43947979-43948001 CAGGCTCGCCCACAGTTATCTGG - Intronic
1184432782 22:44451237-44451259 CAGGGTCTCCCACAGGTTGCCGG - Intergenic
1184744156 22:46446352-46446374 CAGGGTCACCCTAAGCAGGCAGG - Intronic
1185062291 22:48613392-48613414 CAGGGGCATCCACAGTGGGCTGG - Intronic
1185398692 22:50605130-50605152 CAGGGTCCCCCACAGTGCCCAGG + Intronic
954672533 3:52298612-52298634 CAGGGCCACCCACAGAAGCCAGG + Intergenic
954793199 3:53147831-53147853 TATGGTCACCCACAGTACCCTGG - Intergenic
958931939 3:100216558-100216580 CAGGGTCACCCTCATTAGGACGG + Intergenic
958951460 3:100421314-100421336 CAGGTCCACCCACAGTATGGAGG + Intronic
960996311 3:123342755-123342777 CAGGGTCATCCACAGTAAGAAGG + Intronic
962260304 3:133897765-133897787 CAGAGTCCCCCAAAGTAAGCTGG - Intergenic
965672286 3:171159123-171159145 CAGGGGCAAGCACAGCAAGCCGG + Intronic
967118987 3:186365934-186365956 CAGGGTCACCAACCGCAAGGTGG + Intergenic
975377817 4:73665921-73665943 CAGGCCCACCCACAGTTATCCGG - Intergenic
975615126 4:76238241-76238263 CAGGCTAACCCAAAGTAACCTGG - Intronic
977893968 4:102344397-102344419 TAGGGACACCCACAGTACGGAGG + Intronic
989399234 5:40991523-40991545 CAGGGTCAGCCAAACTAAACAGG + Intergenic
996769035 5:127066193-127066215 GAGATTAACCCACAGTAAGCAGG + Intronic
999228607 5:150047998-150048020 CAAGGTCACACACAGTAAGGAGG - Intronic
999740466 5:154546098-154546120 AAAGGTAACCCAGAGTAAGCAGG - Intergenic
1003721746 6:8710867-8710889 CAGGCCCACCCACATTAAGGAGG + Intergenic
1005532489 6:26721961-26721983 CAGGAACACCCACAGTACCCAGG + Intergenic
1005535911 6:26755633-26755655 CAGGAACACCCACAGTACCCAGG - Intergenic
1005538306 6:26779704-26779726 CAGGAACACCCACAGTACCCAGG - Intergenic
1007253485 6:40512280-40512302 CAGTGTTATCCACAGGAAGCGGG - Intronic
1019109342 6:169697502-169697524 CAGGCTCGCCCACTGTAATCCGG + Intronic
1019564656 7:1673419-1673441 CAGTGGCACCGACAGTAAACAGG + Intergenic
1022911013 7:34899539-34899561 CGGGGACACCCCCAGAAAGCAGG - Intergenic
1024342137 7:48277240-48277262 CAGGGGCGCCCACAGCAGGCAGG + Intronic
1028234301 7:88341871-88341893 CAGAGTAGCCCACAGGAAGCTGG + Intergenic
1028360755 7:89963879-89963901 GAGGGCCACCCACATTAAGGAGG + Intergenic
1035925591 8:3724613-3724635 CTGGGTCACTCCCAGTATGCAGG + Intronic
1039702728 8:39978644-39978666 CAGGGTCAGCGATAGCAAGCAGG + Intronic
1041037902 8:53813967-53813989 CAGGCTCACCCAGAGGCAGCTGG + Intronic
1043978313 8:86608533-86608555 CAGGCTCACCCGCAGTTATCCGG + Intronic
1048454960 8:134569563-134569585 CAGGGTCACTCAGGGTGAGCAGG - Intronic
1048807709 8:138255869-138255891 CAGGGTCAGGCACAGTAAGGAGG - Intronic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1053567534 9:39269003-39269025 CACGGGCAACCACAGGAAGCCGG + Intronic
1053833550 9:42109954-42109976 CACGGGCAACCACAGGAAGCCGG + Intronic
1054129609 9:61349995-61350017 CATGGGCAACCACAGGAAGCCGG - Intergenic
1054597000 9:67077460-67077482 CACGGGCAACCACAGGAAGCCGG - Intergenic
1060585366 9:124782194-124782216 CATGGCCACCCACAGTCACCAGG - Intronic
1060801537 9:126548600-126548622 CACTGTCACCCACATTCAGCAGG + Intergenic
1061898374 9:133660323-133660345 CAAGGTCACCCAGAGTAAGCCGG + Intergenic
1062447962 9:136603622-136603644 CAGGGTCACCCAGAGTAGCCTGG - Intergenic
1186441532 X:9591123-9591145 CAGGGTCACGGGGAGTAAGCAGG - Intronic
1186677037 X:11829100-11829122 GAGGCTCACCCACATTATGCAGG + Intergenic
1186684243 X:11908047-11908069 AAGGGTGACCCACAGGAAGCTGG - Intergenic