ID: 1080701657

View in Genome Browser
Species Human (GRCh38)
Location 11:34649472-34649494
Sequence TGTGAAACACACACCCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080701657_1080701660 1 Left 1080701657 11:34649472-34649494 CCTTGATGGGTGTGTGTTTCACA 0: 1
1: 0
2: 2
3: 14
4: 199
Right 1080701660 11:34649496-34649518 AAAGGGTGAATATACTAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 156
1080701657_1080701663 27 Left 1080701657 11:34649472-34649494 CCTTGATGGGTGTGTGTTTCACA 0: 1
1: 0
2: 2
3: 14
4: 199
Right 1080701663 11:34649522-34649544 TGTAGTTAACAAATTTTTAGGGG 0: 1
1: 0
2: 2
3: 38
4: 420
1080701657_1080701661 25 Left 1080701657 11:34649472-34649494 CCTTGATGGGTGTGTGTTTCACA 0: 1
1: 0
2: 2
3: 14
4: 199
Right 1080701661 11:34649520-34649542 ATTGTAGTTAACAAATTTTTAGG 0: 1
1: 0
2: 3
3: 30
4: 490
1080701657_1080701662 26 Left 1080701657 11:34649472-34649494 CCTTGATGGGTGTGTGTTTCACA 0: 1
1: 0
2: 2
3: 14
4: 199
Right 1080701662 11:34649521-34649543 TTGTAGTTAACAAATTTTTAGGG 0: 1
1: 1
2: 1
3: 52
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080701657 Original CRISPR TGTGAAACACACACCCATCA AGG (reversed) Intronic
900387712 1:2418117-2418139 TGCGAGGCAGACACCCATCACGG + Intergenic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
903776445 1:25797195-25797217 AGAGAGACACACACACATCAGGG + Intergenic
904342777 1:29848145-29848167 TGTGAAACACACACAGAGAAAGG + Intergenic
904577964 1:31517595-31517617 TCTGTAACACACACCCATTGGGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
909569665 1:77094831-77094853 TGTGAAACACATACCTGTCAAGG - Intronic
910015906 1:82522922-82522944 AATGACACACACAACCATCAAGG - Intergenic
912168965 1:107074559-107074581 TGTGATACACACGCACACCATGG + Intergenic
912761689 1:112373092-112373114 TGTTATACACACACACACCATGG + Intergenic
916480745 1:165212204-165212226 GGTGAAGCACACACCCACCACGG - Intronic
917681192 1:177369673-177369695 TGTTGAACACACTCCCATCCTGG + Intergenic
922452940 1:225751217-225751239 TGGGAAGCAGACACCCAGCAGGG + Intergenic
923045157 1:230350374-230350396 TGTGAAACATGCACCCATGTTGG + Intronic
923239697 1:232071087-232071109 TGACAAACCCACACCCAACAAGG - Intergenic
1064338939 10:14469424-14469446 TTTAAAACAGACACCCCTCATGG - Intergenic
1066598505 10:37078166-37078188 TGTGATACACACACACACGAGGG - Intergenic
1069241030 10:66139347-66139369 GCTGAAACACAAAGCCATCAAGG - Intronic
1070761636 10:79027774-79027796 TGTGGTCCACACACCCACCACGG + Intergenic
1072976782 10:100065787-100065809 TGTGATAAACACACCCCTCTGGG + Intronic
1073970654 10:109043013-109043035 TGGGAAACACTCAGGCATCACGG + Intergenic
1077808621 11:5614865-5614887 TGTGAAACTCATCACCATCAAGG + Intronic
1077982706 11:7317007-7317029 TGTAAAACACATAACCAACAAGG - Intronic
1078699194 11:13664989-13665011 TCTTATATACACACCCATCATGG - Intergenic
1079335466 11:19566840-19566862 TCTGAAAGACACACCCACAAAGG + Intronic
1080701657 11:34649472-34649494 TGTGAAACACACACCCATCAAGG - Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081379949 11:42402149-42402171 TGTGAAATACTCTCTCATCATGG - Intergenic
1085834670 11:79939812-79939834 TGTGAAACACAGCCCAAGCAGGG - Intergenic
1086836169 11:91625815-91625837 TGGGAAGCACACACCCACAATGG - Intergenic
1088016953 11:105072309-105072331 TGTGAGCCACCCACCCATCCTGG + Intronic
1088019505 11:105102211-105102233 TGTGAGCCACCCACCCATCCTGG + Intergenic
1088867192 11:113859734-113859756 TGTAAAGTACACACCCAACAAGG + Intronic
1090239171 11:125170050-125170072 TGTCACACACACACCAGTCAGGG - Intronic
1090755528 11:129786657-129786679 TGTTTAACACACACACACCAAGG + Intergenic
1093625024 12:21335723-21335745 TCCCAAACACACACACATCAAGG + Intronic
1094416853 12:30225441-30225463 GGTGAAACAGACAGGCATCACGG + Intergenic
1095793755 12:46195356-46195378 TGGGAAACACCTCCCCATCAGGG - Intronic
1101804090 12:108048280-108048302 TATAAAACACACACCAATGAGGG + Intergenic
1101990840 12:109483469-109483491 TGTGAAAAACACACACAGAAAGG - Intronic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1103644128 12:122377306-122377328 GTTGAAATACACACACATCAGGG - Intronic
1104451219 12:128869627-128869649 TGTGAAAGACACACGCAGCTCGG - Intronic
1108204652 13:48075390-48075412 TGAGAAACACTCACCAACCAGGG + Intronic
1109098957 13:58154894-58154916 TGTGAAATACACACACATTGTGG - Intergenic
1109374971 13:61480520-61480542 TGACAAACACACAGCCAACATGG - Intergenic
1110007069 13:70286273-70286295 TGTGATACACACACACACAATGG + Intergenic
1117486323 14:56201365-56201387 TGTGAAATACTCACTCATCCTGG + Intronic
1117676518 14:58160664-58160686 TATGAAACACAAACTCATCTAGG - Intronic
1118008854 14:61589989-61590011 TGTGAACCCCACTCCCACCACGG + Intronic
1119366938 14:74100986-74101008 TCTTAAACACACACAAATCAGGG - Intronic
1120595527 14:86430568-86430590 TTGGAAACACATACCCAGCAGGG - Intergenic
1120993658 14:90398480-90398502 TGTGGAAAACACACCCAGCGAGG - Intronic
1202836452 14_GL000009v2_random:80636-80658 AGTGCAACACACACACAGCAGGG + Intergenic
1123849123 15:24335829-24335851 TGTGAAATAAGCACACATCATGG + Intergenic
1123868185 15:24543341-24543363 TGTGAAATAAGCACACATCATGG + Intergenic
1123932015 15:25176503-25176525 TGTGGAATACTTACCCATCATGG - Intergenic
1123942843 15:25224902-25224924 TGTGGAACACCGACTCATCATGG - Intergenic
1123948910 15:25252082-25252104 CGTGGAACACTGACCCATCACGG - Intergenic
1124722301 15:32120825-32120847 TGTGGAACACAGAGCCAGCACGG + Intronic
1129061766 15:72866151-72866173 TGTGCAACACACAACCTACATGG - Intergenic
1133496979 16:6328074-6328096 TGTGACACAAACACACATAATGG + Intronic
1133615780 16:7475592-7475614 TGTGAGCCACACACCCAGCTAGG + Intronic
1137337423 16:47564029-47564051 TGACAAACACACACACACCATGG - Intronic
1137917292 16:52445972-52445994 GGTGAGACAAAGACCCATCAAGG - Exonic
1138559464 16:57792055-57792077 TGGGAAACACATACCCTTCAAGG - Intronic
1140577374 16:76186812-76186834 AGGGAAACCCACACCCACCATGG + Intergenic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1146110835 17:30087649-30087671 TGTGGTATACACACACATCATGG - Intronic
1146647961 17:34587803-34587825 TGTGACAAACAAAGCCATCATGG - Intronic
1148350380 17:46937520-46937542 TGTAACTCACACTCCCATCAAGG + Intronic
1149634802 17:58157826-58157848 TTTGAAACAAACATCCATCATGG - Intergenic
1153009533 18:525466-525488 TATCAAACACACACCCTTCCAGG + Intergenic
1153225087 18:2893891-2893913 TGGGAGACACACAGTCATCATGG - Intronic
1153929298 18:9864733-9864755 TGTTATACACACACACATAAAGG - Intergenic
1156704630 18:39864862-39864884 TGATGAACACAAACCCATCAAGG - Intergenic
1157137927 18:45075722-45075744 TTTGAAATACACACCTATAAAGG + Intergenic
1158933830 18:62346685-62346707 TGTGGGGCACACAGCCATCACGG - Intronic
1160800236 19:964255-964277 TGTGAACCGCATCCCCATCATGG + Exonic
1161626930 19:5332592-5332614 TGAGAATCACACACCCGCCATGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1163287602 19:16358174-16358196 TTGGAAACACAGACCCGTCAAGG - Intronic
1165013687 19:32865994-32866016 TGTAAATTACACACCAATCAAGG + Intronic
1166271927 19:41719793-41719815 TGTGATACACACACCTGCCATGG + Intronic
1166277003 19:41761111-41761133 TGTGACACACACACCTGCCAGGG + Intronic
1166406096 19:42522896-42522918 TGTGAAACACACACTTGCCATGG - Intronic
1166415157 19:42589851-42589873 TGTGACACACACACCCACCGTGG - Intronic
1166424184 19:42661511-42661533 TGTGACACACACACCTGCCATGG + Intronic
1167979925 19:53266832-53266854 TGGGAAACATACACTCATTAAGG + Exonic
1167985961 19:53315949-53315971 TGGGAAACATACACTCATTAAGG - Intergenic
1202636187 1_KI270706v1_random:46729-46751 AGTGCAACACACACACAGCAGGG - Intergenic
925982611 2:9189491-9189513 TGTGAAAAACACAAGCATCTAGG + Intergenic
927671918 2:25075553-25075575 TGTTAAACACACACAGAGCAAGG - Intronic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
937107081 2:119325988-119326010 TGTAAAACATACATCCAACAAGG - Intronic
937990518 2:127659558-127659580 TCTGAAACACACACCCAAGGTGG + Intronic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
942301181 2:174563989-174564011 TGTAAACCAGACACCTATCATGG + Intronic
945951459 2:216042693-216042715 TGAGACACACACACACATAAAGG + Intronic
947231781 2:227894581-227894603 TGTGACAGACACACACAGCATGG + Intronic
947340850 2:229137811-229137833 TTTTAAACATACACACATCAAGG + Intronic
948523621 2:238557585-238557607 TGTGAAACACACAACCTAAAGGG - Intergenic
948967495 2:241394770-241394792 TGAGTAACATGCACCCATCATGG + Intronic
1169166245 20:3426562-3426584 TGTGAAACATAAACCAAACATGG + Intergenic
1172012620 20:31854739-31854761 TCAGACACACACACCCAGCAAGG - Intronic
1174929596 20:54798458-54798480 TGTGGTACACACACACACCACGG - Intergenic
1176969441 21:15248825-15248847 TGTGAAACACACCCCAATAGTGG + Intergenic
1179718434 21:43302020-43302042 TGTGTAACACACACTCCTGATGG + Intergenic
1179777010 21:43671317-43671339 TGTGAAACACAAAGACAGCAGGG - Intronic
1180327394 22:11442565-11442587 TGTGAAACAAAAACCCTCCATGG - Intergenic
1180379033 22:12121382-12121404 CGTGAAACACAAACCCTCCATGG - Intergenic
1180418491 22:12791934-12791956 CGTGAAACACAAACCCTCCATGG + Intergenic
1182831531 22:33308274-33308296 TGGGGAACTCACACCCACCAAGG + Intronic
1183179125 22:36246788-36246810 GGTCAGACACTCACCCATCAAGG + Intergenic
1184557675 22:45241754-45241776 TGTGGACCCCAGACCCATCAAGG + Intergenic
1184793158 22:46713784-46713806 TTTGTAACTCAAACCCATCAAGG - Intronic
1184810649 22:46829361-46829383 TGTGGAACTCACCCCCTTCATGG + Intronic
1184880035 22:47298935-47298957 TGTCTCACACACACCCATTATGG - Intergenic
950289562 3:11772554-11772576 TGTGATACATACACACACCATGG - Intergenic
951276629 3:20695211-20695233 TGTGAAACACACAAATATGAAGG + Intergenic
951531719 3:23704478-23704500 TGTGCAACACACACACACAATGG - Intergenic
954117080 3:48472974-48472996 TCTCAAACACACACGCAGCATGG + Intronic
957221361 3:77387184-77387206 TCTAAATCACACACCCACCAGGG - Intronic
957891608 3:86365931-86365953 TATGAAACAGAGACACATCATGG + Intergenic
958803718 3:98784538-98784560 TGTGAAACACACCTCCATATAGG - Intronic
958814053 3:98896116-98896138 TTTCAATTACACACCCATCAGGG + Intronic
959765415 3:110021250-110021272 TGTGAAATAAGCACACATCATGG + Intergenic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
962168501 3:133076274-133076296 TGTGAAACAGACACACAGAAGGG - Intronic
962374264 3:134847153-134847175 GTTAAAACACACACACATCATGG + Intronic
962923585 3:139972287-139972309 TGTAAAACCCACACCCCCCAGGG - Intronic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
965370008 3:167850306-167850328 TGTGAAATACAGGACCATCAAGG - Intergenic
966508241 3:180731227-180731249 TGAGAAACTCACATCCACCAAGG - Intronic
967570542 3:191022979-191023001 TGAGAAACAGAAACACATCAAGG + Intergenic
967877650 3:194277756-194277778 TCAGAAACATACACCCAGCAAGG + Intergenic
968318898 3:197748404-197748426 AGTGAACCACACACCTATCAAGG - Intronic
968575018 4:1361776-1361798 TTTTAAACACATAGCCATCAAGG + Intronic
970384739 4:15544632-15544654 TGTGAAACACACTCCCACTATGG + Intronic
972025149 4:34366229-34366251 TGTGAAAGCCAAAGCCATCATGG - Intergenic
972559383 4:40213387-40213409 TCTCACACACACACCCATCTTGG + Intronic
973365996 4:49210115-49210137 AGTGCAACACACACACAGCAGGG - Intergenic
973394602 4:49582336-49582358 AGTGCAACACACACACAGCAGGG + Intergenic
973882433 4:55287496-55287518 GGTCAAACATACGCCCATCAAGG - Intergenic
976090664 4:81453957-81453979 TGTGAAACCCAACCCGATCAAGG + Intronic
981067820 4:140504110-140504132 AGTGTCACAAACACCCATCAAGG + Intergenic
981525992 4:145707600-145707622 TATTAAGCACACACCCATCATGG + Intronic
983035674 4:162863150-162863172 TGAGAAACACATGCACATCAAGG - Intergenic
983187437 4:164716395-164716417 AGTGAAACACCCACCCTACAGGG - Intergenic
984486217 4:180373889-180373911 TTTAAAACACACACACAGCATGG - Intergenic
985241564 4:187936131-187936153 TGTGAAACATTCACTCAGCATGG - Intergenic
1202760652 4_GL000008v2_random:106862-106884 CGTGAAACACAAACCCTCCATGG - Intergenic
1202763501 4_GL000008v2_random:132596-132618 AGTGCAACACACACACAGCAGGG - Intergenic
985944457 5:3166573-3166595 TGTGAAACACACACAGATCTTGG - Intergenic
990178873 5:53138102-53138124 TGTAGAACACACATCCTTCAGGG - Intergenic
993355716 5:86904699-86904721 TGGGAAACACACAATCAACAGGG + Intergenic
994214136 5:97118101-97118123 TGTGAGACACTCACTCATCGGGG - Intronic
995242300 5:109899232-109899254 TGTGACGCCCACACACATCAGGG - Intergenic
999953392 5:156674153-156674175 TGTGAGACACACAAACATAATGG + Intronic
1000455984 5:161449682-161449704 TGTAGTACACACACCCATAAGGG - Intronic
1001823767 5:174729605-174729627 TTTGAAACAAGCATCCATCATGG - Exonic
1004935919 6:20508418-20508440 TGTGAGACCCACTCACATCAGGG - Intergenic
1005923599 6:30421226-30421248 TGTGAAACACACAGACATGGAGG - Intergenic
1006516977 6:34550655-34550677 GGTGAAACTCACACAGATCAGGG - Intronic
1008321895 6:50124564-50124586 TATGAGACACAAATCCATCAGGG - Intergenic
1008439067 6:51511581-51511603 TGTGAAACTCACTCCCACAAAGG + Intergenic
1013239221 6:108228053-108228075 TATGAAACATACACCAATCAAGG + Intronic
1013480353 6:110547526-110547548 TGTGAAACTCACACTCTGCATGG - Intergenic
1013735675 6:113223790-113223812 AGTGAAATACACACGAATCATGG - Intergenic
1015567872 6:134592215-134592237 TGAGAAACTCACAGCCATGAGGG + Intergenic
1015658855 6:135550374-135550396 TTTGACACACCCACACATCACGG - Intergenic
1018444774 6:163845607-163845629 TGTGAAACCATCACCCATCAAGG + Intergenic
1018649115 6:165976647-165976669 TGTGAAACTCAGACCCTTCACGG + Intronic
1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG + Intronic
1022423631 7:30246912-30246934 TGTGTAACACAAACCCAACTGGG - Intergenic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1024137573 7:46426272-46426294 TGAGGAGCACACACCCCTCAGGG + Intergenic
1025006391 7:55358612-55358634 TGTTACACACACACAAATCAAGG - Intergenic
1030115915 7:106062228-106062250 TGTGAATCATGCACCCAGCAGGG - Intergenic
1031101710 7:117488802-117488824 TGTGAAAAACACAACCATGTAGG - Intronic
1032624010 7:133569651-133569673 TGTAAGACACACACACATAATGG + Intronic
1034337360 7:150332171-150332193 TGTGTAGCACACACTCATCATGG + Exonic
1036501367 8:9317505-9317527 TTTGTAACACACTCTCATCATGG + Intergenic
1040328336 8:46373627-46373649 TGTGAAATACACACACACCCTGG + Intergenic
1041019874 8:53627725-53627747 TCTGAAACACAAACCCAGCCTGG + Intergenic
1041620916 8:59968129-59968151 AGTGATACTCATACCCATCAGGG + Intergenic
1042189182 8:66168202-66168224 TGTGAAATAGACACCTATGATGG + Intronic
1044986901 8:97763841-97763863 TGTGAAACTCACAATTATCATGG + Intergenic
1045064419 8:98433213-98433235 TGTGAAACAGACACCCCTGCAGG + Intronic
1046035517 8:108836307-108836329 TGTGAAACTCACAGCTACCATGG + Intergenic
1047998105 8:130356448-130356470 AGTGAAAGACAGACCCATGATGG + Intronic
1048236476 8:132695735-132695757 TGTGAAAAAAACACACATCCGGG - Intronic
1049326105 8:142022364-142022386 TGTGAATCCTGCACCCATCAGGG + Intergenic
1049860548 8:144895345-144895367 TGTGACACACATACCCTTCATGG - Intronic
1051388558 9:16539040-16539062 TGGTAAACACACACACACCATGG - Intronic
1054862316 9:69966673-69966695 TTTAAAACACACACACATAATGG - Intergenic
1058063163 9:100520870-100520892 AGTGAAACAACCACACATCATGG - Intronic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1058501518 9:105623618-105623640 TGTGGACCACACTCCCATCCAGG + Intronic
1058960298 9:109986727-109986749 TATGAAACACACAGACTTCAAGG - Intronic
1061503829 9:131019530-131019552 TGTGAAACAGAGACTCATCCAGG - Intronic
1062304336 9:135894440-135894462 TGTAAAACAAACACCCAGCCTGG + Intronic
1062711471 9:137977493-137977515 TGTGAAACACACTGCCTCCAAGG - Intronic
1203541422 Un_KI270743v1:91747-91769 CGTGAAACACAAACCCTCCATGG - Intergenic
1203544256 Un_KI270743v1:117469-117491 AGTGCAACACACACACAGCAGGG - Intergenic
1190165578 X:48070861-48070883 TCTGAAAAAGCCACCCATCATGG + Intronic
1190582329 X:51901432-51901454 TGTGATACACACACACACAATGG - Intronic
1191079833 X:56498050-56498072 ATGGAAACACACACACATCAGGG - Intergenic
1194337187 X:92662838-92662860 TGTGGCACACACACACACCATGG + Intergenic
1197206253 X:123793148-123793170 CCTGAAACACTCACCCCTCATGG - Intergenic
1198657545 X:138931429-138931451 TGTGAAACTCCAACCCACCAGGG + Intronic
1199349327 X:146781927-146781949 TATCACACACACACACATCACGG - Intergenic
1201513263 Y:14788814-14788836 TGTTTACCACACACCCATCCGGG + Intronic