ID: 1080703637

View in Genome Browser
Species Human (GRCh38)
Location 11:34667678-34667700
Sequence CTGTGAATATGGGGGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080703637_1080703647 12 Left 1080703637 11:34667678-34667700 CCATGGTCCCCCCATATTCACAG No data
Right 1080703647 11:34667713-34667735 CTCAAAGCAGAGACATCTTCAGG No data
1080703637_1080703648 13 Left 1080703637 11:34667678-34667700 CCATGGTCCCCCCATATTCACAG No data
Right 1080703648 11:34667714-34667736 TCAAAGCAGAGACATCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080703637 Original CRISPR CTGTGAATATGGGGGGACCA TGG (reversed) Intergenic
No off target data available for this crispr