ID: 1080705995

View in Genome Browser
Species Human (GRCh38)
Location 11:34693337-34693359
Sequence CGAATTATGAAATATGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080705995_1080705997 3 Left 1080705995 11:34693337-34693359 CCAGGTGCATATTTCATAATTCG No data
Right 1080705997 11:34693363-34693385 AGCTTTTTGTCTTCTATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080705995 Original CRISPR CGAATTATGAAATATGCACC TGG (reversed) Intergenic
No off target data available for this crispr