ID: 1080712368

View in Genome Browser
Species Human (GRCh38)
Location 11:34761459-34761481
Sequence AGTATTGGACTCTTTTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080712365_1080712368 8 Left 1080712365 11:34761428-34761450 CCTCTGGTAGAATTCGGCTGTGA 0: 5309
1: 5374
2: 2476
3: 988
4: 423
Right 1080712368 11:34761459-34761481 AGTATTGGACTCTTTTTGATTGG No data
1080712363_1080712368 15 Left 1080712363 11:34761421-34761443 CCTTGTACCTCTGGTAGAATTCG 0: 4080
1: 3098
2: 947
3: 284
4: 195
Right 1080712368 11:34761459-34761481 AGTATTGGACTCTTTTTGATTGG No data
1080712361_1080712368 24 Left 1080712361 11:34761412-34761434 CCAATTCTTCCTTGTACCTCTGG No data
Right 1080712368 11:34761459-34761481 AGTATTGGACTCTTTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080712368 Original CRISPR AGTATTGGACTCTTTTTGAT TGG Intergenic
No off target data available for this crispr