ID: 1080719905

View in Genome Browser
Species Human (GRCh38)
Location 11:34838615-34838637
Sequence AGCCCTGAGATGGGAGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080719905_1080719913 14 Left 1080719905 11:34838615-34838637 CCTCTACCTCCCATCTCAGGGCT No data
Right 1080719913 11:34838652-34838674 CTATGTTCAAAGTTATCTTTGGG No data
1080719905_1080719912 13 Left 1080719905 11:34838615-34838637 CCTCTACCTCCCATCTCAGGGCT No data
Right 1080719912 11:34838651-34838673 CCTATGTTCAAAGTTATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080719905 Original CRISPR AGCCCTGAGATGGGAGGTAG AGG (reversed) Intergenic
No off target data available for this crispr