ID: 1080721592

View in Genome Browser
Species Human (GRCh38)
Location 11:34854519-34854541
Sequence ATTATTATGAAGGACATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080721588_1080721592 7 Left 1080721588 11:34854489-34854511 CCAAGAGACACAGCTCTGGCTGA 0: 1
1: 0
2: 2
3: 42
4: 224
Right 1080721592 11:34854519-34854541 ATTATTATGAAGGACATAGAGGG 0: 1
1: 0
2: 2
3: 35
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080721592 Original CRISPR ATTATTATGAAGGACATAGA GGG Intronic
902706007 1:18205020-18205042 GTTATCATGTAGGACAGAGAGGG + Intronic
904387984 1:30158873-30158895 ATTTTACTGAAGGACATAAAAGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905153791 1:35956163-35956185 ATGATGATGGAGGGCATAGATGG + Intronic
906715066 1:47962523-47962545 ATTATTATTAAGGGCAAAGGGGG - Intronic
906992881 1:50757503-50757525 AATATTATGAAGGACAGATGGGG - Intronic
907203449 1:52748407-52748429 ATATTTATGAAGTACATAGGTGG + Intronic
907677188 1:56529180-56529202 AGTATGATGAAGGCCAGAGAGGG + Intronic
907701633 1:56793958-56793980 ATTTTTATAAAGCACTTAGAGGG - Intronic
907833046 1:58083392-58083414 AGTATTATGAAGGCCAGAGCTGG + Intronic
909429287 1:75568370-75568392 ACTCTTTGGAAGGACATAGATGG + Intronic
909857310 1:80552668-80552690 ATTATTTTCAAGGAGCTAGAGGG + Intergenic
910004217 1:82375726-82375748 ATTATAATTATGGACATAGTTGG + Intergenic
910086006 1:83403483-83403505 ATTATAATGAAAGACAGAGCTGG - Intergenic
910544698 1:88400817-88400839 ATCATTTTGAAGGACCTAAAAGG - Intergenic
911747580 1:101456361-101456383 GTTATGATGAAGTACAGAGAGGG + Intergenic
911808563 1:102243696-102243718 TTTATTTTGAATGAAATAGAAGG + Intergenic
912139799 1:106710063-106710085 AATATTAAGAAGGACAGTGAAGG - Intergenic
913209890 1:116573386-116573408 ATTTGCACGAAGGACATAGAAGG + Intergenic
915816523 1:158972830-158972852 AGTATTATAAAGGAAATAAATGG - Intronic
916169653 1:161992010-161992032 TTAATTATGAAGGTCCTAGATGG + Intronic
916177916 1:162057980-162058002 ATTATTATGAAAGGCAGAGGCGG + Intergenic
916295481 1:163214502-163214524 CTGATGATGAAGGAGATAGAGGG - Intronic
916340790 1:163731633-163731655 AATAATATGAAGGATATATATGG + Intergenic
917061459 1:171046048-171046070 ACTATAAGGAAGGACAAAGAAGG - Intronic
918338743 1:183549149-183549171 ATTAATATTAAGAAAATAGAAGG + Intronic
918515842 1:185361706-185361728 ATGATTAAAAAGGACAAAGAAGG + Intergenic
919079528 1:192853308-192853330 ATTATTATAAAGGACATTAATGG - Intergenic
919191264 1:194222872-194222894 ATTCTAATGAAAGAAATAGAAGG + Intergenic
919256037 1:195126332-195126354 ATTATAATTAAGGACAGGGAAGG + Intergenic
920814260 1:209316156-209316178 ATTATTATCAAGGACATGAATGG - Intergenic
921664957 1:217857826-217857848 TTTGTTTTGGAGGACATAGAAGG + Intronic
923992797 1:239457462-239457484 ATTAAATTGAAGGACATAGTTGG - Intronic
924654964 1:245966108-245966130 ATTATGATGAAGAAGAAAGAAGG - Intronic
1062990918 10:1816352-1816374 ATTGTTATAAAGGACAAAGAAGG - Intergenic
1063876125 10:10480610-10480632 ATTGCTATAAAGGACATAGATGG + Intergenic
1064906717 10:20355222-20355244 ATTCTTTTCATGGACATAGATGG + Intergenic
1066224755 10:33371301-33371323 AGTATGATGAAGGAAATAGGTGG - Intergenic
1066399539 10:35062215-35062237 ATTAGTATGCTGTACATAGAGGG - Intronic
1066761359 10:38756486-38756508 ATTATTATGAAGGCCCTTCAGGG - Intergenic
1066960226 10:42215938-42215960 ATTATTATGAAGGCCCTTCAGGG + Intergenic
1067031793 10:42883005-42883027 ATTGGTATGCAGGACCTAGAAGG + Intergenic
1068887334 10:62110954-62110976 ACTACTATGAAAGAAATAGATGG + Intergenic
1070036955 10:72735158-72735180 ATTTTTATTAATGACATGGATGG + Intronic
1070528617 10:77316770-77316792 ATTGTTATGAAGGTCAAAGGAGG + Intronic
1071344177 10:84675758-84675780 ATTATTTTGCAGGAGAGAGAAGG + Intergenic
1071524023 10:86347793-86347815 ATTATTATGACTCACATGGAGGG + Intronic
1072531137 10:96320726-96320748 ATCAGTATGAAGGACACAGAAGG + Exonic
1072833975 10:98691496-98691518 ATTATTATGGCTGACAGAGAGGG - Intronic
1074124921 10:110521171-110521193 AATATTATCAGGGACAAAGAAGG - Intergenic
1075260340 10:120958129-120958151 ATTCTTCTCAAGGACATATAAGG + Intergenic
1075423109 10:122319271-122319293 ATTATTAAGTAGGACACACAAGG - Intronic
1075990246 10:126831539-126831561 ATTAATATTAAGAAAATAGAAGG + Intergenic
1078448133 11:11420349-11420371 ATAATTATGCAGGACAGATATGG + Intronic
1078532887 11:12150645-12150667 ATTAGTCTGGAGGATATAGAGGG - Intronic
1080265225 11:30393218-30393240 TCTATTAGGAAGGACACAGAGGG - Intronic
1080423005 11:32128593-32128615 ATTATCAAAAAGGACAAAGAAGG + Intergenic
1080721592 11:34854519-34854541 ATTATTATGAAGGACATAGAGGG + Intronic
1081164694 11:39793176-39793198 ATAATTATGAAGGAAATAAATGG - Intergenic
1085137529 11:74106213-74106235 AGTACTATGAAGGAAATAAATGG - Intronic
1085633416 11:78139050-78139072 ATTGTGATAAAGGAAATAGAGGG - Intronic
1086994169 11:93337729-93337751 GTTATTAGGAAGGAGAGAGAGGG + Intronic
1087464438 11:98487244-98487266 ATCATGATGAATGACCTAGAAGG - Intergenic
1087479170 11:98678373-98678395 ACTATTAAGAAGGGCAAAGAAGG - Intergenic
1087528554 11:99349978-99350000 ATTAGAATGAAGGTGATAGAAGG + Intronic
1090927651 11:131263121-131263143 ATGTTTTTGAAGGACATAAAGGG - Intergenic
1092252459 12:6907559-6907581 ATTATTATCAAGACCATAGTTGG + Intronic
1092762161 12:11819984-11820006 ATTATTAGGAAGGCCTTGGAAGG - Intronic
1093080886 12:14809494-14809516 ATTATTATTAAACAGATAGAAGG - Intronic
1093081221 12:14813761-14813783 ATTAATATTAATGACATAGAAGG + Intronic
1093773268 12:23041878-23041900 ATTATTTTGAAGGAGATATCTGG + Intergenic
1095301275 12:40586772-40586794 AATATTATGAAGGAGATAATGGG + Intergenic
1097649288 12:62275907-62275929 ATAATTATTGAGGATATAGAAGG + Intronic
1099279126 12:80620791-80620813 ATTGTTATGAGTGACATAAAGGG - Intronic
1100393176 12:94162111-94162133 AGTATTTTGAAGGAAATAAATGG + Intronic
1100841640 12:98618919-98618941 ATTATAATGAAGTACAGAAATGG + Intronic
1101302751 12:103498210-103498232 AGTATCATGAAGTACAGAGAAGG + Intergenic
1101622816 12:106406265-106406287 ATGGTTTTGAAGGACAGAGATGG + Intronic
1104932412 12:132346785-132346807 ATTCTTACGGATGACATAGAAGG - Intergenic
1105757330 13:23479513-23479535 ATTATTACTAAAGACAAAGAAGG - Intergenic
1107385439 13:39903419-39903441 AATATTATCCAGTACATAGAAGG + Intergenic
1108938455 13:55916788-55916810 ATTATTAAGATGGAAAAAGAAGG + Intergenic
1109744021 13:66597093-66597115 TTTATTTTTAAAGACATAGATGG - Intronic
1109768119 13:66932005-66932027 ATTATTATGAATGAAGTATATGG + Intronic
1109895408 13:68680873-68680895 AATATTATTAGGGACAAAGAAGG + Intergenic
1110723750 13:78795640-78795662 TTAATTAGGAAGGACAAAGAAGG - Intergenic
1111216369 13:85147787-85147809 ATTCTCATGAATGACAGAGATGG - Intergenic
1112711456 13:102134180-102134202 ATTCTAATGAAGGACATGGTAGG + Intronic
1113353719 13:109556060-109556082 CTTATTTTGAAGGATACAGATGG + Intergenic
1116639383 14:47441483-47441505 AACATTCTGAAGGACATAGTAGG + Intronic
1116802398 14:49456451-49456473 ATTACTAGGAAGGCAATAGATGG + Intergenic
1120802335 14:88704619-88704641 ATGATTATAAAGGACATTGTTGG - Intronic
1120802468 14:88706977-88706999 ATGATTATAAAGGACATTGTTGG - Intronic
1121947626 14:98137930-98137952 ATTATTGTGAGGGAAACAGAAGG - Intergenic
1122684249 14:103492399-103492421 ATGATTATGAAAGACATGCATGG - Intronic
1202932067 14_KI270725v1_random:46777-46799 ATTATTATGAAGGCCCTTCAGGG - Intergenic
1125148096 15:36496519-36496541 ATTGTTACGAAGAAAATAGAAGG - Intergenic
1125300506 15:38250080-38250102 ATTATGATTAAGTAAATAGAAGG - Intergenic
1125388946 15:39171472-39171494 ATTATTGTGATGGACATTGACGG + Intergenic
1125448761 15:39785982-39786004 ATTTTTATGAATGACTTTGAAGG - Intergenic
1125972823 15:43925911-43925933 AGTGCTATGAAGGACATAAATGG - Intronic
1126224124 15:46249777-46249799 AAAATTATTAAGGATATAGAAGG + Intergenic
1127401899 15:58596256-58596278 ATTGCTATGCAGGAAATAGAAGG - Exonic
1128625111 15:69193356-69193378 CTGAATATGAAGGACAAAGAGGG - Intronic
1129000852 15:72332631-72332653 AAAATTATGAAGGATAAAGAGGG - Intronic
1130689541 15:86069611-86069633 AGTATTACCAAAGACATAGAGGG + Intergenic
1130867730 15:87946762-87946784 ATTATTAATAAGGGCACAGAGGG - Intronic
1131639891 15:94281318-94281340 ATAATCAAGAAGGACAAAGAAGG - Intronic
1132087090 15:98917237-98917259 ATAATTAGGAAGGGCAGAGATGG - Intronic
1133411365 16:5571934-5571956 TTAATTATGAAAGACAAAGATGG - Intergenic
1133817022 16:9205339-9205361 ATTAATATCAAGAACTTAGAAGG + Intergenic
1135226596 16:20664391-20664413 ATGATTAGGAAGGACAAAGGAGG + Intronic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1138274337 16:55721361-55721383 TCTATTAAGAAGGACAAAGAAGG + Intergenic
1138890538 16:61138775-61138797 ATTATTTAGAAAGAAATAGATGG + Intergenic
1139213016 16:65099404-65099426 AATATTCTGAAGGACACAGCTGG - Intronic
1140747648 16:77995248-77995270 ATTATTATAAAGAACAAACAGGG + Intergenic
1141012486 16:80415901-80415923 GTGACTCTGAAGGACATAGAGGG - Intergenic
1142995619 17:3758454-3758476 ATTATTATTATTGAGATAGATGG + Intronic
1146206447 17:30909017-30909039 ATGATTATGAATGACCTATAGGG + Intronic
1148764563 17:50029509-50029531 GTTCTGATGGAGGACATAGAGGG + Intergenic
1149103237 17:52930700-52930722 CTTATCATGAAGTACAGAGAAGG - Intergenic
1149267486 17:54943053-54943075 AAAATTATGAGGGACAAAGAAGG - Intronic
1152354603 17:79800747-79800769 ATTTTTATGAAGGAAATTGTCGG + Intronic
1153738420 18:8097163-8097185 ATAGTTATTAAGGAAATAGAAGG - Intronic
1154086985 18:11315981-11316003 ATTAATATGATGGAAAGAGATGG - Intergenic
1155541171 18:26869909-26869931 ATTATTAGAAAGGTCATCGAAGG - Intergenic
1155827426 18:30465420-30465442 ACTAATAAGAAGGACAAAGATGG + Intergenic
1155924286 18:31638177-31638199 ATTATTATAAAAGAAATATATGG + Intronic
1156974318 18:43198588-43198610 TTTATCATGAAGGAAATATAGGG + Intergenic
1157660416 18:49436783-49436805 ATTTTAATGAAGCACAGAGAAGG - Intronic
1158014694 18:52770429-52770451 ATTGTTATGAAGGACATTGAGGG - Intronic
1158087351 18:53667839-53667861 ATTATTTTTAAGGAAATAGATGG - Intergenic
1159982415 18:74800555-74800577 ATAATTAGGAAGGCCATAGATGG - Intronic
1168488498 19:56786511-56786533 ATTATTTTGGAGGAAATACATGG + Intronic
927934694 2:27069761-27069783 ATTATTCTGAATGACAGAAATGG - Intronic
928229801 2:29488247-29488269 ATTATTAAGAAGTAAATAGTAGG - Intronic
928710237 2:33996985-33997007 ATTATTATTAAAAACATAAATGG - Intergenic
928740285 2:34343743-34343765 ATTATTATTAAGCACTAAGAAGG - Intergenic
929713965 2:44292347-44292369 ATTATTATCAAGCATAGAGATGG - Intronic
930279775 2:49356296-49356318 ATTATTAGGAAGGACAAGGAAGG + Intergenic
931000261 2:57772161-57772183 TTTATTATGAAGCACTTAAAAGG + Intergenic
931129535 2:59318666-59318688 ATTCTTATGAAAGATAAAGAGGG + Intergenic
931310684 2:61076908-61076930 ATTTTTATGAAGGCCAAACATGG + Exonic
932105865 2:68942169-68942191 ATAATTAAGAAAGACAAAGAAGG - Intergenic
933511917 2:83250733-83250755 ATTACTATAAAGGACATAATTGG + Intergenic
934324666 2:92001160-92001182 ATTATTATGAAGGTCCTTCAGGG - Intergenic
934463048 2:94231865-94231887 ATTATTATGAAGGCCCTTCAGGG - Intergenic
936268392 2:111029142-111029164 ATTTTTAAGAAGGACTTAGTTGG + Intronic
936883842 2:117284779-117284801 ATTGTTATAAAGGAAATAGGTGG + Intergenic
939436892 2:142188579-142188601 ATTTTTATTGAGCACATAGATGG - Intergenic
939467254 2:142574037-142574059 ATCATGATGGAGGACATACAGGG + Intergenic
940262165 2:151792437-151792459 TTTAATATGATGGACATAAATGG + Intronic
940432882 2:153614414-153614436 ATTATCATGAAGAATATAGTAGG + Intergenic
940675318 2:156719933-156719955 ATTATTATTAATGACACTGATGG + Intergenic
940894749 2:159070192-159070214 ATAATTATGGAGGAGCTAGATGG - Intronic
941361929 2:164561995-164562017 AATATTAGGAAGGAAATAGCAGG + Intronic
941985860 2:171511059-171511081 TATATTATGAAGGACATAAAAGG + Intergenic
943013001 2:182474594-182474616 ATTATTATAAAGCACATAGTAGG + Intronic
943444244 2:187963812-187963834 ATTATTAGAGAGGACATAGAAGG - Intergenic
944563568 2:200964983-200965005 GTTATTATGAAGGGCTTAGTTGG + Intergenic
945333935 2:208569801-208569823 ATTATTATTAAGGACATGGCAGG + Intronic
946500212 2:220239150-220239172 ATTATTATTTAGGAAATAGGTGG + Intergenic
946576318 2:221079813-221079835 ATAATTATTAAGGAAATGGAAGG + Intergenic
946815520 2:223574102-223574124 ATTATATTGAATGACATAAATGG - Intergenic
947830378 2:233136175-233136197 ATTATTAAAAAGTAAATAGAAGG + Intronic
948954474 2:241276701-241276723 ATCATTATTAAGAACAGAGAAGG + Intronic
1169617326 20:7463588-7463610 ATTTTTATGAAGTACAAAAATGG + Intergenic
1170357146 20:15505433-15505455 ATTATAAAGAAGCAGATAGATGG + Intronic
1172674713 20:36660285-36660307 ATTAATCTGAAGCACATATAAGG + Intronic
1175469049 20:59212846-59212868 ATTAATCTGAAGGGCATGGATGG - Intronic
1175972591 20:62694250-62694272 TTTATTATGAAGGACATTGCAGG + Intergenic
1176594096 21:8674915-8674937 ATTATTATGAAGGCCCTTCAGGG - Intergenic
1177229531 21:18301895-18301917 ATTATTTTTGAGGTCATAGATGG + Intronic
1177739780 21:25140129-25140151 AATGTTATGAAGGAGATACACGG + Intergenic
1177968289 21:27757196-27757218 ATGATTATGAAGGACCTAGCTGG + Intergenic
1178999136 21:37438716-37438738 ATTATTATTAAGGCCACAGAAGG - Intronic
1179528748 21:42003166-42003188 ATTTTTATGAAGGACAGAAGAGG + Intronic
1180276950 22:10652045-10652067 ATTATTATGAAGGCCCTTCAGGG - Intergenic
1180584170 22:16870945-16870967 ATTATTATGAAGGCCCTTCAGGG - Intergenic
1182025170 22:27112321-27112343 ATTATTATTTGGGAGATAGAGGG - Intergenic
1182589799 22:31370333-31370355 AATATTATGAAGTCCATTGATGG + Intergenic
950164841 3:10788268-10788290 TTTATTTAAAAGGACATAGAAGG + Intergenic
951100419 3:18682011-18682033 CTTATTATGAAGAACAGAGGTGG - Intergenic
951457820 3:22912544-22912566 ATTAGTCTGAAGAATATAGAAGG - Intergenic
952078031 3:29722523-29722545 TTTATTATAAAGGACATTTATGG - Intronic
952539624 3:34354049-34354071 ATTATTATTAAGACCATAGAAGG + Intergenic
955358964 3:58256325-58256347 AACATTATAAAGGACATAGTTGG - Intronic
956127644 3:66026280-66026302 ATTATGTTGAAGGTCTTAGAGGG - Intronic
957361070 3:79159069-79159091 ATTATTGTGAAAGACAAAGTAGG + Intronic
958035450 3:88164838-88164860 ACTTTTATGAAAGACAAAGAAGG + Intronic
958121544 3:89296114-89296136 ATCCTTATGGATGACATAGAGGG - Intronic
958460459 3:94387826-94387848 ATAATTAAAAAGGACAAAGAAGG + Intergenic
958678719 3:97297557-97297579 ATTAATATGAAGGTCCCAGAAGG + Intronic
959000098 3:100954324-100954346 ATTATAAACAAGGACAAAGAAGG + Intronic
959047387 3:101489544-101489566 ACAATTAAGAAGGACAAAGATGG + Intronic
959572036 3:107895221-107895243 ATCGTTGTGAAGGACACAGATGG - Intergenic
959672013 3:108989672-108989694 ATTATTATGAAGGAGCCATAAGG + Intronic
959987522 3:112592129-112592151 ATGATTATGAGAGACAAAGAAGG - Intergenic
960015478 3:112883301-112883323 ATGATTAAAAAGGACAAAGAAGG - Intergenic
962070395 3:132027812-132027834 ATTATCATTAAAGACAAAGAAGG - Intronic
962534419 3:136315075-136315097 ATGATTATGAAAGACAAAGATGG + Intronic
963000321 3:140674465-140674487 ATTATTCTGAAGTAAATATACGG - Intergenic
963228545 3:142887978-142888000 GTTATTATGATGGAGACAGATGG - Intronic
963529183 3:146451930-146451952 TTTATTATAAAGGATACAGATGG - Intronic
963638403 3:147828148-147828170 AATGTTAGTAAGGACATAGAAGG + Intergenic
964095712 3:152929108-152929130 ATAATTATGAATGAGAGAGAAGG + Intergenic
964417624 3:156464360-156464382 ATTATTCAGCAGGACTTAGAAGG + Intronic
965040575 3:163501235-163501257 ATTTTTTTTAAGTACATAGATGG + Intergenic
965072291 3:163929929-163929951 ATTATTATAAGGGAAATAGTTGG - Intergenic
965747947 3:171945178-171945200 ATTTTAATGAAGAACATATAAGG + Intergenic
965903986 3:173679871-173679893 CATATTCTGTAGGACATAGAGGG - Intronic
967649646 3:191970825-191970847 ATTCTTATGATTGATATAGAAGG + Intergenic
967657372 3:192067136-192067158 ATTATTATCAAGGTCAAAAAGGG + Intergenic
969966885 4:11005635-11005657 ATGCTCATGAAGGACACAGAGGG - Intergenic
970068872 4:12131272-12131294 TGCATTATGAAAGACATAGAAGG + Intergenic
971127242 4:23767521-23767543 ATCAATATAAAGGACATTGATGG - Intronic
971151195 4:24033357-24033379 TTTATAATAAAGGAGATAGAAGG + Intergenic
974273397 4:59682228-59682250 ATTATTATTAAGGAAATTTATGG - Intergenic
974792175 4:66706294-66706316 AGTATTATGAAAAAAATAGAAGG + Intergenic
975076894 4:70220842-70220864 ATATTTATGAAGCACATAGTTGG + Intergenic
976052705 4:81028204-81028226 ATTATTCTGAATGACATGGCTGG + Intergenic
976193539 4:82511874-82511896 ATTATTATTAAAGATATAAACGG - Intronic
976492785 4:85691595-85691617 ACAATTAAGAAGGACAAAGAAGG - Intronic
977125205 4:93156698-93156720 ATCATCTTGAAGGACATATAAGG + Intronic
978002324 4:103571585-103571607 GTTATTATGATAGTCATAGATGG + Intergenic
979681370 4:123463556-123463578 ATTATTATTCAGGAGACAGATGG + Intergenic
979782772 4:124675346-124675368 ATTATCATGAAGAACATATGAGG + Intronic
979959196 4:126995915-126995937 ATTATTATTTAAGAAATAGAAGG + Intergenic
980572990 4:134647241-134647263 ATTATTATTTAGGCCATAGAAGG - Intergenic
980999175 4:139811625-139811647 TTTATTTTGATGCACATAGATGG + Intronic
982896904 4:160941928-160941950 ATTATTATGAAGAAAATAGTAGG - Intergenic
983031952 4:162813989-162814011 ATTATTATGTGGGACAGATAAGG - Intergenic
983131497 4:164024971-164024993 ACAATTAAGAAGGACAAAGAAGG + Intronic
983738394 4:171092599-171092621 AATATTATGAAAAACAAAGAAGG + Intergenic
983805890 4:171990275-171990297 ATAAATATGAAGTACTTAGAAGG - Intronic
984044955 4:174785324-174785346 TTTATTTTGAAGGCCATAGTGGG - Intronic
984693378 4:182754434-182754456 ATTATTATCCAGGACATAAATGG - Exonic
984774915 4:183473182-183473204 ATAATTATGAAGGAAATAAAGGG - Intergenic
986006200 5:3671202-3671224 AATACTATGAAGAACATACATGG - Intergenic
986999912 5:13650143-13650165 ATTGTTAGGAATGATATAGATGG + Intergenic
987448193 5:18047971-18047993 ACTATTATGAACCACAAAGATGG - Intergenic
988027880 5:25722951-25722973 ATTAATAAGAAGGAAATAAAAGG + Intergenic
988213481 5:28240737-28240759 GTTCTTATGAAGAACATAGAGGG + Intergenic
988685771 5:33523706-33523728 ATTATTTTGGAGGACAATGATGG + Exonic
990096438 5:52120155-52120177 CTTTTTAAGAAAGACATAGAGGG - Intergenic
990669190 5:58108354-58108376 AAAATTTAGAAGGACATAGAAGG + Intergenic
991366702 5:65876125-65876147 ATTAGTATGTATCACATAGAAGG - Intergenic
991550932 5:67835164-67835186 CTTATTATAAAGAACACAGATGG + Intergenic
993370125 5:87082982-87083004 AATTTTATGAAGAAGATAGAAGG - Intergenic
993662551 5:90656251-90656273 ATTATTATGAAGTACAAATTAGG - Intronic
993699849 5:91105690-91105712 ATTAATATGCAGAACATACAAGG - Intronic
994031361 5:95147456-95147478 ACTATCAAGAAGGACAAAGAAGG - Intronic
996138562 5:119875689-119875711 ATTTTTATGAAGAAGATAGCTGG - Intergenic
997033258 5:130156654-130156676 AATATTAGTAAAGACATAGATGG + Intronic
998648825 5:144094210-144094232 GTTATTATAAAGGAAATATAAGG + Intergenic
999047148 5:148481844-148481866 ATTAATCTGAAGGACAAAGCTGG + Exonic
999294245 5:150448398-150448420 ATTATTATGAAGGTCATAATAGG - Intronic
999715598 5:154357570-154357592 ATTATTTTGAAGGCCAAATAAGG - Intronic
1001626615 5:173141191-173141213 AGTACTGTGAAGGACACAGAAGG + Intergenic
1003701493 6:8470247-8470269 ATTATTATGGAGAACAGAAATGG - Intergenic
1005200287 6:23336851-23336873 TGTATCCTGAAGGACATAGAAGG + Intergenic
1005282634 6:24290639-24290661 ATTATTGTGAAGAAGATACAGGG - Intronic
1005594362 6:27364898-27364920 ATTATTATAAAGCAAATATAAGG + Intergenic
1008154073 6:47991979-47992001 ATTATTTTGAAGGAACTAAAGGG + Intronic
1008778520 6:55071843-55071865 TATATTATGTAGGACATATAAGG + Intergenic
1009502623 6:64434938-64434960 CAAATCATGAAGGACATAGATGG - Intronic
1009694679 6:67087066-67087088 ATGATTAAAAAGGACAAAGAAGG - Intergenic
1009704099 6:67222287-67222309 ATGATTAAAAAGGACAAAGAAGG + Intergenic
1009802282 6:68553865-68553887 ACTATTCTGAAAGACAGAGAAGG + Intergenic
1009983929 6:70759529-70759551 ATTATCATGAAGGATATTGAGGG + Intronic
1010839940 6:80637016-80637038 ATTATTAATAAAGACATACATGG - Intergenic
1010922915 6:81706305-81706327 AATGTTATGAAGGACAGAGCTGG - Intronic
1012193452 6:96309687-96309709 ATTATTAGGAAGTCCTTAGAAGG + Intergenic
1015028830 6:128569689-128569711 ATTTTACTGAAGGAAATAGAGGG + Intergenic
1015094848 6:129403004-129403026 ATTATTACAAAGGTCATAGGAGG + Intronic
1015694756 6:135967663-135967685 ATTCTTATGAAGGACAGTTATGG - Intronic
1015949630 6:138538670-138538692 AAAATAATGAAGAACATAGATGG + Intronic
1016011192 6:139138847-139138869 ATTACTATGTAGGAAAAAGATGG - Intronic
1016101699 6:140109743-140109765 ATTTCTTTGAAGGACATAAATGG + Intergenic
1016116640 6:140293801-140293823 AGTATAATGAAGGCCATATATGG + Intergenic
1016239516 6:141912958-141912980 ATTATTATGAAGGGAAAGGATGG + Intergenic
1016541883 6:145175180-145175202 ACTATTATGAAACACAGAGAAGG + Intergenic
1016661960 6:146592054-146592076 ATCCTGATGAAGGACATCGAAGG - Intergenic
1020493371 7:8817232-8817254 GGTATTATAAAGGACATAGCTGG + Intergenic
1020567825 7:9819883-9819905 GTTATTATGAAGGTAATAAACGG - Intergenic
1020603830 7:10309876-10309898 ATTATTGTGATGGAAATAAATGG - Intergenic
1020734432 7:11929417-11929439 AATATTCTGAAGAACAGAGAGGG - Intergenic
1022014975 7:26341795-26341817 ATTATTATGACAGACACATAAGG + Intronic
1023111476 7:36816107-36816129 ATTGTTATGAAAGACAAATAAGG + Intergenic
1024186566 7:46954263-46954285 ATTATTATGAAGCCCAAGGAAGG - Intergenic
1024273893 7:47661915-47661937 AGTTTTATGAAGGACGTAGGAGG - Intergenic
1024347831 7:48330863-48330885 ATTAGTATGAAGTGCATTGAGGG + Intronic
1024441098 7:49418814-49418836 ATATTAATGCAGGACATAGAAGG - Intergenic
1024614097 7:51093563-51093585 ATTATTATGAATGCCACAGCAGG + Intronic
1025925125 7:65952667-65952689 TTTATTTTCAAGGACAGAGAAGG - Intronic
1025935636 7:66034142-66034164 AATATTCTGAATGACAGAGAAGG - Intergenic
1025948704 7:66125725-66125747 AATATTCTGAATGACAGAGAAGG + Intronic
1026773312 7:73215497-73215519 ATTATTATAAAGGAGACAGCTGG - Intergenic
1027014171 7:74768893-74768915 ATTATTATAAAGGAGACAGCTGG - Intergenic
1027073862 7:75177139-75177161 ATTATTATAAAGGAGACAGCTGG + Intergenic
1027899686 7:84095266-84095288 ATTATTATGTAGCATATATATGG + Intronic
1031179031 7:118391883-118391905 GTTATTTTCAGGGACATAGACGG + Intergenic
1032116256 7:129119967-129119989 ATTATTATCTAGAACATACAAGG - Intergenic
1032133698 7:129254231-129254253 ATTGATATGGAGGACAAAGATGG + Intronic
1033110246 7:138567149-138567171 ATAATTGTGAAGGACTTAGAAGG + Intronic
1033907312 7:146221211-146221233 ATTATTGGGAAGGACACAAAGGG - Intronic
1034742209 7:153486597-153486619 ATAATTAATAAGGACATAGAAGG + Intergenic
1034884931 7:154792080-154792102 ATTAGCATGAAGGACATAGAGGG + Intronic
1037709984 8:21347825-21347847 AGTATTAAGAAAGACAAAGATGG + Intergenic
1039745463 8:40421983-40422005 CTTATTATGAAGCACACAGGAGG - Intergenic
1040666899 8:49644250-49644272 AATATTATGAGTGACATAAAGGG + Intergenic
1041739317 8:61141168-61141190 GTTAATATGGAGGACCTAGAGGG - Intronic
1042783557 8:72520801-72520823 AATATTATGAAGGCAATAAAAGG + Intergenic
1043387438 8:79762249-79762271 AATATGATGAAGTAGATAGATGG - Intergenic
1043528089 8:81118412-81118434 AGTATTTTGAAGGACAGAGATGG - Intergenic
1044206595 8:89498061-89498083 ATTATTATAAATGACATTTAAGG - Intergenic
1045910754 8:107406695-107406717 ATTATTATAAACGACAAAAAGGG - Intronic
1046378471 8:113419722-113419744 ACTATTATAAAGGAGATAAAAGG - Intronic
1046403882 8:113746726-113746748 AATGTTATCAAGGACATAGTTGG + Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1047863634 8:128996385-128996407 TTTATTATGAAAAACATAGGAGG + Intergenic
1048413035 8:134195519-134195541 CTTATAACAAAGGACATAGAGGG + Intergenic
1050497195 9:6256002-6256024 CATATTATGAAGGACAAAGAAGG - Exonic
1050808193 9:9710181-9710203 ATTATAATGAAGGTAAGAGAGGG + Intronic
1050945652 9:11513363-11513385 AGTATAATGAAGAACACAGATGG - Intergenic
1051495121 9:17712750-17712772 AACACTGTGAAGGACATAGATGG - Intronic
1051499101 9:17757974-17757996 ATTATTATGGAGGACCGAGGTGG + Intronic
1051499321 9:17759670-17759692 ATAATTATTAAGGACAGAGATGG + Intronic
1055343588 9:75311008-75311030 ATAATTAAGAAGGACAAAGAAGG - Intergenic
1058210846 9:102167924-102167946 GTTATTATGAAGAAACTAGAAGG + Intergenic
1058451419 9:105099993-105100015 ATTCTAATGGATGACATAGATGG + Intergenic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1061600480 9:131666766-131666788 ATTAATATGAAAGAAAAAGAAGG - Intronic
1203624230 Un_KI270749v1:155149-155171 ATTATTATGAAGGCCCTTCAGGG - Intergenic
1185801954 X:3019308-3019330 ATTATTTTGATGGATATAAAAGG + Intronic
1186022634 X:5273435-5273457 ATTATCATAAAGTACATAAAGGG + Intergenic
1186536543 X:10355878-10355900 CTTATTATGAATGAGATAGAAGG + Intergenic
1187687790 X:21833011-21833033 ATTATTTTGCAGGAAATAGAAGG - Intergenic
1188979350 X:36713181-36713203 AGCATAATGGAGGACATAGAGGG + Intergenic
1189379856 X:40494911-40494933 ATTATTAGGAAGCAGATACAAGG - Intergenic
1190973222 X:55373054-55373076 ATTAATATGCAGGATATATAAGG - Intergenic
1192720161 X:73687149-73687171 CTTATAATGATGGACATATAGGG - Intergenic
1193188639 X:78543339-78543361 ATTATCAAAAAGGACAAAGAAGG - Intergenic
1193884380 X:86966335-86966357 ATGATTATAAAAGACAAAGAAGG + Intergenic
1195849352 X:109266301-109266323 ATTATCATGAAGTATCTAGATGG - Intergenic
1197933791 X:131720301-131720323 ATTCTTATAAAGTTCATAGAAGG + Intergenic
1202080545 Y:21079616-21079638 CTTTTTAGGAAGGTCATAGAGGG + Intergenic