ID: 1080722661

View in Genome Browser
Species Human (GRCh38)
Location 11:34865219-34865241
Sequence CAATACCACCACATTCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080722661 Original CRISPR CAATACCACCACATTCATTT GGG Intronic
901014029 1:6217561-6217583 GAATAGCACCACATTCACTCAGG + Intronic
903747622 1:25598844-25598866 CAGTTCCACCACTTTCTTTTTGG - Intergenic
909450168 1:75789281-75789303 TTATTCCACCACATTCATGTTGG - Exonic
913598650 1:120402766-120402788 TAATGCCTCCACTTTCATTTCGG - Intergenic
914309881 1:146457350-146457372 TAATGCCTCCACTTTCATTTCGG - Intergenic
914511831 1:148339385-148339407 TAATACCTCCACTTTCATTTCGG + Intergenic
915532713 1:156512435-156512457 CAATGCCACCACAACCATCTGGG - Intergenic
915678460 1:157554588-157554610 CAATATCCCCTCATTTATTTAGG + Intergenic
915680186 1:157573945-157573967 CAAGACCCACACATTCCTTTTGG + Exonic
924254026 1:242164274-242164296 CACTTCCCCCACATTCACTTGGG - Intronic
1063287787 10:4709245-4709267 CAGCACCACCACATTCACATTGG - Intergenic
1063679700 10:8175189-8175211 CAACAACTTCACATTCATTTTGG + Intergenic
1064141274 10:12792592-12792614 CACCACCACCACATTGGTTTTGG + Intronic
1064756568 10:18576767-18576789 CAATACCACCACAATCTGCTCGG - Intronic
1064761123 10:18622143-18622165 AAATACCATCACATTGAGTTCGG - Intronic
1068070982 10:52195290-52195312 CAAAAGCAACACCTTCATTTTGG - Intronic
1068780654 10:60916137-60916159 CACCTCCACCACATTCTTTTGGG - Intronic
1069325046 10:67223273-67223295 CACTACCACAACATACATTTAGG - Intronic
1075208616 10:120469577-120469599 CATTTCCATCACATTCATTGTGG - Intronic
1077909542 11:6562311-6562333 CATAACCAATACATTCATTTGGG + Intronic
1078898700 11:15621555-15621577 GAATATCACCACTTTCCTTTAGG - Intergenic
1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG + Intergenic
1080722661 11:34865219-34865241 CAATACCACCACATTCATTTGGG + Intronic
1082907417 11:58324976-58324998 TAATATCACCACTTTTATTTTGG + Intergenic
1086325822 11:85698313-85698335 CATTAGCACATCATTCATTTGGG + Intronic
1086727988 11:90212651-90212673 TAATACCACCAAATGAATTTAGG + Intronic
1086942736 11:92815246-92815268 CAAAGCCACCACTCTCATTTTGG - Intronic
1088601013 11:111475614-111475636 CAACACCATCACATGAATTTAGG + Intronic
1089011849 11:115137843-115137865 CGATGCCACCACATTCAGATGGG - Intergenic
1092514698 12:9197316-9197338 CTGTACCACCACATTCTCTTTGG + Intronic
1092514706 12:9198000-9198022 CTGTACCACCACATTCTCTTTGG - Intronic
1096869237 12:54583156-54583178 AAAAACCCCCACATTCATTAGGG - Intronic
1097312412 12:58134564-58134586 TAATACCAAAATATTCATTTTGG + Intergenic
1105734236 13:23251316-23251338 CTGTCCCACCACATTCCTTTGGG + Intronic
1107259511 13:38473410-38473432 CACTTCCACCACATTCTCTTGGG + Intergenic
1107903493 13:45041330-45041352 CAATACCTCCAGTTTCCTTTAGG - Intergenic
1108224820 13:48277786-48277808 CAATACCACAACATTCAGGAAGG - Intergenic
1109850011 13:68050517-68050539 CAACACCAGCTCATTCTTTTAGG + Intergenic
1111206914 13:85022317-85022339 CAATACCAGCACCTTCATCTTGG + Intergenic
1111293300 13:86196240-86196262 CAAAACCACCATATTCCTTGTGG + Intergenic
1112755975 13:102634061-102634083 CAATGCCTCCACATGCATTGGGG - Exonic
1113893765 13:113749975-113749997 CAAGACCAGCACAGTCATCTCGG + Intergenic
1113982253 13:114286244-114286266 AAATTCTACTACATTCATTTCGG - Intronic
1114714659 14:24812480-24812502 CAATAGCATCAGCTTCATTTTGG - Exonic
1119415054 14:74464345-74464367 CAATACCATAGGATTCATTTAGG - Intergenic
1119461127 14:74804966-74804988 CAATACAAAGACATTCATTAGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124718362 15:32088624-32088646 CAATACCACCATATACCTATCGG - Intronic
1126578652 15:50222065-50222087 CCATTCAACCACAGTCATTTAGG - Intronic
1126872630 15:53006142-53006164 GAATACCACCCCATTCCTTGAGG - Intergenic
1128559561 15:68655715-68655737 TATTACCAACACATTCCTTTGGG - Intronic
1128883105 15:71261379-71261401 CCCTACCAACACATTGATTTTGG + Intronic
1132127835 15:99245186-99245208 CAGTACCACCACGTTGTTTTGGG - Intronic
1132368498 15:101276503-101276525 CAAAACCACCGCTTTCATTTCGG + Intronic
1136054718 16:27680017-27680039 CACTCCCACCACATCCACTTGGG + Intronic
1137753712 16:50885355-50885377 AAATAACCCCACATTCCTTTGGG + Intergenic
1138294656 16:55875939-55875961 CAACACCACCACCCCCATTTTGG + Intronic
1138618711 16:58194875-58194897 AAATACCAGCATGTTCATTTAGG - Intronic
1140631810 16:76862528-76862550 CAATACTAGCACAGTCCTTTAGG - Intergenic
1150368615 17:64614984-64615006 AAATACTACCATTTTCATTTAGG + Intronic
1150617955 17:66786448-66786470 AAATGCCAACACTTTCATTTGGG - Intronic
1157065447 18:44343787-44343809 CAAGATAACCACACTCATTTTGG - Intergenic
1159124555 18:64207969-64207991 CAACACCACCTCATGCAATTTGG - Intergenic
1159522620 18:69545669-69545691 AAAGACTACTACATTCATTTTGG + Intronic
1165195607 19:34100445-34100467 CAATAACTCCTCATTCCTTTAGG - Intergenic
925812653 2:7716071-7716093 CAATAAAATCACATTCATTTTGG + Intergenic
926416079 2:12651029-12651051 TGATACCACCTCATTCATTTTGG + Intergenic
927921201 2:26973007-26973029 CAATACCATTACATAGATTTAGG - Intronic
928870814 2:35976378-35976400 CTACATCACCACAATCATTTGGG - Intergenic
929176663 2:38985117-38985139 CAACACCACCACATTTTGTTTGG + Exonic
929615105 2:43300498-43300520 CAGTGCCATCGCATTCATTTTGG - Intronic
931016581 2:57988564-57988586 CAATACCATTTCATTCAATTTGG - Intronic
933930443 2:87145556-87145578 CATGACCGCCACATTAATTTGGG - Intergenic
938109911 2:128557038-128557060 CAATACCATCATCTGCATTTTGG - Intergenic
938856958 2:135323057-135323079 GTATACCACTCCATTCATTTAGG + Intronic
940482183 2:154247701-154247723 CAATACAACCACATAAATTATGG - Intronic
940589550 2:155703744-155703766 CACTACCACAATATTCATCTTGG + Intergenic
941434684 2:165454546-165454568 CAACACCACCACAGTTATTTGGG + Intergenic
941648339 2:168066199-168066221 CACTACCACCATAGTTATTTTGG - Intronic
943281716 2:185943167-185943189 CACTAGCAACACATTAATTTTGG + Intergenic
1169167791 20:3439382-3439404 CAATACCACATTATTTATTTTGG - Intergenic
1169548285 20:6673644-6673666 CAATACCATCATATTGAGTTAGG + Intergenic
1173725244 20:45293029-45293051 CACTCCCACCCCATCCATTTAGG + Intergenic
1174225677 20:48997667-48997689 TAATACCACATCATTTATTTCGG + Intronic
1175112461 20:56658216-56658238 CATTATCACCATCTTCATTTTGG - Intergenic
1178808889 21:35862681-35862703 CAAGCCCACCATATTCATTTTGG - Intronic
1182143933 22:27985167-27985189 CGACACCAGCACATACATTTTGG - Intronic
1183868061 22:40719925-40719947 CACTGCCAACACCTTCATTTTGG - Intergenic
1184203952 22:42988816-42988838 CAATGACATCACATGCATTTGGG + Intronic
950998842 3:17534167-17534189 GAATAACATCACTTTCATTTAGG + Intronic
952243684 3:31562243-31562265 CAATACCAGCACAGACACTTAGG - Intronic
953174303 3:40535575-40535597 AAATACCCCTACAATCATTTTGG + Exonic
955980149 3:64517053-64517075 CAATACCTCCACCTTAATTTGGG - Exonic
956964835 3:74447114-74447136 CAATACTACATCATTCTTTTTGG - Intronic
957391255 3:79573659-79573681 AATTACCAACACATTCAATTAGG + Intronic
957497260 3:81007973-81007995 CAAAAGCACATCATTCATTTGGG - Intergenic
959143136 3:102510398-102510420 AATTACCACCACAGCCATTTGGG + Intergenic
959523403 3:107346334-107346356 CAACAGAACCACAATCATTTTGG + Intergenic
960505217 3:118485703-118485725 CAAAATGACCACATTTATTTTGG + Intergenic
963354044 3:144188018-144188040 AAATAAAACCAAATTCATTTGGG + Intergenic
964296206 3:155236393-155236415 CTATCCCACCACAGTCATGTAGG - Intergenic
964991770 3:162821452-162821474 CAATCTCACCAAATTCAATTTGG + Intergenic
965367509 3:167818697-167818719 AACTACCACCACCATCATTTTGG + Intronic
966065960 3:175822257-175822279 CTATGCCACCCCATACATTTTGG + Intergenic
966266133 3:178046781-178046803 CAAAACCACCACAATCTTTGAGG - Intergenic
967775803 3:193384582-193384604 CAACACCACCACATTTTGTTTGG - Intergenic
969834099 4:9825057-9825079 CAATACCACTAGAATCCTTTTGG - Intronic
971584143 4:28383503-28383525 TAATGCCACCACATTAATATGGG - Intronic
971837839 4:31791738-31791760 CAATTCCACCACATTGCTATTGG - Intergenic
974201959 4:58654306-58654328 CATTACCAACACATGAATTTGGG - Intergenic
974381421 4:61145351-61145373 AAATACCACCCTATACATTTAGG - Intergenic
976705492 4:88015173-88015195 CAGTACCACCCCAATTATTTTGG - Intronic
976756469 4:88503647-88503669 TAGTTACACCACATTCATTTTGG + Intronic
977031053 4:91883445-91883467 CAATACCACAACATAAATTGTGG - Intergenic
977791679 4:101112092-101112114 AAATACCAAGACATTAATTTAGG + Intronic
980901196 4:138907070-138907092 CAACTCCACTATATTCATTTAGG - Intergenic
981470716 4:145131483-145131505 AAATGTTACCACATTCATTTAGG - Intronic
981935126 4:150230985-150231007 CAGTAGCACCACACTGATTTGGG - Intronic
982117370 4:152108779-152108801 CAATTCCACCTCATTCATCAAGG - Intergenic
985375617 4:189334291-189334313 CAATACTGCCACATTAAATTAGG + Intergenic
987595561 5:19993361-19993383 TAATAGCACCACATTCATTGTGG - Intronic
988125160 5:27023203-27023225 TAATTCCACCACATACAATTTGG + Intronic
989993762 5:50801698-50801720 CAATACCCCCACTTTCATAATGG - Intronic
991608997 5:68431313-68431335 CAAAACCACCACACTGTTTTTGG - Intergenic
991866878 5:71070830-71070852 CAAAAACACCACAATAATTTGGG - Intergenic
993455100 5:88118790-88118812 AAATACGACCACATTCATTAAGG - Intergenic
994682375 5:102904890-102904912 AAATACCATCACAGTCATTATGG + Intronic
995423757 5:111995751-111995773 CTATACTACCACGTTCTTTTTGG - Intronic
995527548 5:113062414-113062436 TAAAACCACAACATTCTTTTTGG + Intronic
995812116 5:116119384-116119406 CTAAGCCAACACATTCATTTTGG - Intronic
997052830 5:130402920-130402942 CACTACAATCACATTCAGTTTGG - Intergenic
997561714 5:134851601-134851623 CAATAGCAGCACTGTCATTTGGG - Intronic
998217629 5:140249395-140249417 CAATTCTACCACAATTATTTGGG + Intronic
999852834 5:155561294-155561316 CACCACCACCACCATCATTTTGG - Intergenic
999917667 5:156281184-156281206 CAATACTACCACATTCATTTAGG + Intronic
1000302652 5:159970289-159970311 CCAAACAACCACATGCATTTTGG - Intronic
1001688026 5:173610231-173610253 CAATACCATCACAAGCATGTGGG + Intronic
1007742994 6:44024097-44024119 CACTATCACCACACTCATGTTGG - Intergenic
1012686981 6:102263502-102263524 GAATAACACAACATGCATTTGGG - Intergenic
1016922078 6:149305972-149305994 AAGTACCACCACAATCAGTTTGG + Intronic
1017316798 6:153040322-153040344 CATTACCACCACATTTTTTGCGG - Intronic
1018567597 6:165171695-165171717 CAGTACAACCACAACCATTTTGG + Intergenic
1018600470 6:165533197-165533219 CAAGAACATCACTTTCATTTAGG - Intronic
1018931435 6:168242639-168242661 CAAATCCACCACATACATGTGGG + Intergenic
1019882803 7:3878012-3878034 ACATATCACCACATTCACTTTGG + Intronic
1020426914 7:8077651-8077673 CAATATTACCACAGTCCTTTAGG + Intronic
1020830917 7:13094404-13094426 CAGTACCAACATATTAATTTAGG - Intergenic
1026342596 7:69447312-69447334 CACTACCACCTCCTTCATTCAGG + Intergenic
1028641470 7:93046639-93046661 AAACACCACCACATGCATTCTGG + Intergenic
1028875095 7:95813134-95813156 CCATACAACCACTTTAATTTGGG + Intronic
1030545757 7:110893231-110893253 CAAAACCAACATATTCTTTTGGG + Intronic
1031592888 7:123614838-123614860 CTATACAACCAAATTCATCTAGG - Intronic
1032160719 7:129507717-129507739 AGATACCACCACATATATTTTGG - Intronic
1034596477 7:152198899-152198921 AAGTACCCCCACATCCATTTCGG + Intronic
1036219060 8:6905607-6905629 TAATATAACCACATTTATTTAGG + Intergenic
1038469728 8:27804740-27804762 TAATACTTCCACATTCTTTTGGG - Exonic
1038973980 8:32671093-32671115 CAAGACCACTATATTCATTTGGG + Intronic
1039241164 8:35558387-35558409 TAATACCATCACAGGCATTTTGG - Intronic
1042269438 8:66940582-66940604 CAGTACCAACACAGTCATTTTGG + Intergenic
1044098169 8:88095593-88095615 CAATACCACCTGATTCATTAGGG + Intronic
1044593721 8:93938826-93938848 CATGACCAACAGATTCATTTGGG + Intergenic
1045446865 8:102275595-102275617 CAAAACCACCCAATTCAGTTAGG + Exonic
1046887556 8:119384310-119384332 CATGACCACCACAGTCATTTGGG + Intergenic
1048751080 8:137676625-137676647 CATTACCACCACATACTTTATGG - Intergenic
1049947140 9:607817-607839 TTTTACCACCACATCCATTTCGG - Intronic
1054838385 9:69705902-69705924 CAAGACTTCCACATTCATTTAGG + Intergenic
1055786587 9:79875682-79875704 CAATACCTTCACATTTATTAGGG + Intergenic
1058242958 9:102589572-102589594 CAATAGCACTACATTCTTTGTGG - Intergenic
1060688444 9:125633839-125633861 TAATATCTCCACATGCATTTAGG - Intronic
1186206640 X:7207335-7207357 CAATGCCAACAAATTCATGTCGG - Intergenic
1189110395 X:38283937-38283959 GAATTCGACCACATTCATTAAGG - Intronic
1196365297 X:114916764-114916786 AGATACCACCACAGTGATTTTGG + Intergenic
1196421108 X:115522397-115522419 AAAACCCACCACTTTCATTTAGG + Intergenic
1196712969 X:118782565-118782587 CCATACCACCACATTCAACTTGG + Intronic
1201680314 Y:16638437-16638459 CTATACAAACACATTCCTTTTGG + Intergenic