ID: 1080727556

View in Genome Browser
Species Human (GRCh38)
Location 11:34913667-34913689
Sequence CAGCCTGGAAGGTGACCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080727556 Original CRISPR CAGCCTGGAAGGTGACCGAG GGG Intronic
900033383 1:387310-387332 CAGTCTGGAAGGGGAACCAGAGG + Intergenic
900054221 1:617199-617221 CAGTCTGGAAGGGGAACCAGAGG + Intergenic
900581022 1:3409298-3409320 GGGCCAGGTAGGTGACCGAGGGG + Intronic
900608377 1:3533895-3533917 GAGCCTGGAGGGTGTCAGAGTGG - Intronic
901666696 1:10830313-10830335 CAGGCTGGGAAGTGACCGAGGGG - Intergenic
903349854 1:22711033-22711055 CGCCGTGGAAGGTGAGCGAGCGG + Exonic
903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG + Intergenic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
905207108 1:36349256-36349278 CACCTTGGAAGGTGACCCAAGGG + Intronic
905223255 1:36463623-36463645 CAGCCTGTATGGGGACAGAGGGG - Intronic
905254434 1:36671053-36671075 GAGACAGGAAGGTGACGGAGTGG + Intergenic
905357701 1:37396315-37396337 CAGACTGGAGGGTGACACAGGGG - Intergenic
908164233 1:61442077-61442099 CAGCCAGGAAGGGGTGCGAGGGG - Intronic
910679093 1:89844008-89844030 CAGCCTGGAAAGCGCCCTAGTGG - Intronic
915127758 1:153678138-153678160 CAGTCTGGAAGGTGGCAGGGAGG + Intergenic
916071719 1:161174046-161174068 CAGCCTGGAAGATAATGGAGGGG + Exonic
918659626 1:187073339-187073361 CAGTGTGGAAGGGGACCCAGCGG + Intergenic
919009038 1:191935962-191935984 CAGCATGGAAGGGGCCCGAGCGG + Intergenic
919781991 1:201227051-201227073 CAGCCTGGAAGGAAACCCCGCGG + Exonic
920364104 1:205439067-205439089 CAGCCTCGCAGGTGACCGCTAGG + Intronic
922255740 1:223891464-223891486 AAGTCTGGAAGGGGAACGAGAGG + Intergenic
922797265 1:228346512-228346534 CAGCCTGGGAGGAGAATGAGGGG + Intronic
1063371224 10:5524203-5524225 CAGGCTGAAAGGTGACCTCGGGG + Exonic
1064409593 10:15093369-15093391 CAGCATCGAAGGTGAAAGAGTGG + Intergenic
1065295106 10:24266824-24266846 CATCGTGGAAGGGGACCGAGCGG - Intronic
1066569763 10:36758242-36758264 GAGCCTGGAAGGAGAGAGAGGGG - Intergenic
1067090800 10:43265035-43265057 CAGCCAGGGAGGAGAGCGAGTGG - Intronic
1069753892 10:70761706-70761728 CAGCCTGGAAGGGGACTCTGTGG + Exonic
1071532467 10:86400620-86400642 CCGCCTGGAAGGTGAGGGTGTGG - Intergenic
1072420481 10:95286955-95286977 CAGCCAGGTAGATGACTGAGAGG - Intronic
1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG + Intronic
1072735452 10:97876023-97876045 CAGACTTGAACGTGACCGTGGGG + Intronic
1072743010 10:97921664-97921686 CAGCCTGGAAGTTGACAGAGAGG - Intronic
1073442142 10:103558587-103558609 CAGCCTGGCAGGAGACCCATGGG + Intronic
1073813522 10:107178536-107178558 CAGGCTGGAATGTCACCCAGTGG + Intergenic
1076169536 10:128307944-128307966 CAGCCAGGAAGGGGGCCCAGGGG - Intergenic
1076594816 10:131618972-131618994 CAGCCTGGGAGGGGCCCGTGGGG + Intergenic
1078418731 11:11189038-11189060 CATCCTGGAATGTGTTCGAGAGG + Intergenic
1080727556 11:34913667-34913689 CAGCCTGGAAGGTGACCGAGGGG + Intronic
1081263644 11:40991805-40991827 CAGGCTGTAATGTGAGCGAGGGG + Intronic
1081421066 11:42874987-42875009 CAGTGTGGAAGGGGACTGAGTGG - Intergenic
1082106873 11:48230009-48230031 CAGTGTGGAAGGGGACCCAGTGG - Intergenic
1083998301 11:66282965-66282987 CAGCCTTCAAGGGGACAGAGAGG - Intronic
1087009757 11:93502012-93502034 CAGGCTAGCAGGTGACCCAGGGG + Intronic
1087177417 11:95108360-95108382 CAGCCAGGAAGGTGTGTGAGTGG + Intronic
1088299433 11:108340519-108340541 CTGCCTGGAAGTTGACCAATAGG - Intronic
1089073256 11:115717252-115717274 CAGCCTGGAGGATGAGGGAGGGG - Intergenic
1089261941 11:117229646-117229668 AAGCCTGGAAGGTGACGGGGAGG - Exonic
1091126993 11:133109314-133109336 CAGCATGGAAGAGGACTGAGTGG + Intronic
1091845997 12:3656803-3656825 CAGGTCGGAAGGTGTCCGAGGGG - Intronic
1094032420 12:26027862-26027884 CAGCCCAGAAGATGACAGAGGGG + Intronic
1094267173 12:28572414-28572436 CTGGCTGGAAGGTGAACGTGAGG + Intronic
1094736545 12:33241054-33241076 CAGCATGGAAGGGGACCAAGTGG + Intergenic
1097521220 12:60672963-60672985 CAGCCTGGAATTTGCCTGAGAGG - Intergenic
1097729133 12:63107672-63107694 CAGCCGGGAAGGGGACTGAGAGG - Intergenic
1101435544 12:104661009-104661031 CAGTCTGGAAGTGGACAGAGTGG - Intronic
1102495220 12:113314880-113314902 CAGCCTGGAAGTTCACCCAGGGG - Intronic
1103167026 12:118778946-118778968 CGGCCTTGGAGGTGACCCAGAGG - Intergenic
1103513406 12:121490612-121490634 CAGCCTGTAAGGTCACAGACAGG + Intronic
1108777498 13:53784334-53784356 CAGCCTTGAGGGGGATCGAGTGG + Intergenic
1110598134 13:77341372-77341394 CAGCCTGGAAGGAGCCCAGGTGG - Intergenic
1113313424 13:109154583-109154605 CAGCCTGGATGGTAAGCTAGTGG - Intronic
1113589119 13:111485962-111485984 CAGCCTGGATGGAGACTGAGCGG + Intergenic
1114590549 14:23860790-23860812 GAGGCTGGAAGATGACTGAGTGG - Intergenic
1116111556 14:40591767-40591789 CAGACTGGAAGCTGAGAGAGAGG - Intergenic
1116522672 14:45869550-45869572 CAGCTTGGAAGATGGCCAAGTGG + Intergenic
1117216604 14:53558555-53558577 AAGCCTGGAAATTGACTGAGGGG - Intergenic
1119863567 14:77954787-77954809 CTGCCGGAAAGGTCACCGAGTGG - Intergenic
1121407729 14:93729078-93729100 CAGCCTAGAAGGTGGCAGTGAGG + Intronic
1121415934 14:93779385-93779407 CAGCCTGGCAGGGGACGGGGTGG - Intronic
1122414420 14:101542034-101542056 CAGCCTGGAGGCTGAGCGGGTGG - Intergenic
1122688593 14:103521405-103521427 CAGCCTGGACGGCGACCTGGCGG - Exonic
1122689443 14:103524837-103524859 CAGCCAGGAGGGTGAGAGAGGGG - Intergenic
1124370508 15:29102302-29102324 TAGCCTGGAGGGGGACAGAGGGG + Intronic
1126530904 15:49710559-49710581 CAGCCTGGAAGCTGTCTGTGAGG + Intergenic
1127968938 15:63944178-63944200 CAGGCTGGAAGGTGGCCGTGGGG + Intronic
1128330321 15:66751415-66751437 CAGCCTGGAAGGGAAGGGAGTGG - Intronic
1130059560 15:80559764-80559786 CATCATGGAAGGTGCCTGAGTGG - Intronic
1130183452 15:81653827-81653849 CAGCGTGGAAGGAGACCCAAGGG + Intergenic
1130258833 15:82338643-82338665 CAGCCTGGAAGGAGCCTGTGGGG + Intergenic
1130282477 15:82530916-82530938 CAGCCTGGAGGGAGACTGAGGGG - Intergenic
1130473804 15:84246683-84246705 CAGCCTGGAAGGAGCCTGTGGGG - Intergenic
1130481217 15:84360747-84360769 CAGCCTGGAAGGAGCCTGTGGGG - Intergenic
1130596089 15:85251298-85251320 CAGCCTGGAAGGAGCCTGTGGGG - Intergenic
1130924160 15:88372708-88372730 CAGCCTGGAGGGAGAATGAGAGG + Intergenic
1131189348 15:90301348-90301370 CAGCCCGGAAGGAGCCTGAGGGG - Intronic
1131428405 15:92366394-92366416 GAGCTTGGAAAGTGACCAAGAGG + Intergenic
1131614945 15:94006258-94006280 CAGCATGGAATGGGACCCAGCGG - Intergenic
1132185143 15:99797336-99797358 CAGCCTGGAGGGAGCCTGAGGGG - Intergenic
1132431845 15:101767219-101767241 CAGCCTGGAGGGAGCCTGAGGGG + Intergenic
1132759130 16:1500478-1500500 CAGCCGGGATGGTGAGCGGGTGG + Exonic
1132865412 16:2090658-2090680 CATCCTGGTAGGTGACTGCGCGG - Exonic
1138549068 16:57737269-57737291 CAGCCTGGAAGTTGCGTGAGTGG + Exonic
1138912074 16:61413170-61413192 CAGCCTGGAATGTGTCAGAGGGG + Intergenic
1141657276 16:85422901-85422923 CAGCCAGGCAGGTGAGCAAGCGG - Intergenic
1144531202 17:16041052-16041074 CAGCCTGGGATGTGATCCAGAGG + Intronic
1144619654 17:16809335-16809357 CAGCCTGGAAGCTGAGCATGAGG - Intergenic
1144893031 17:18506369-18506391 CAGCCTGGAAGCTGAGCATGAGG + Intergenic
1145139186 17:20437923-20437945 CAGCCTGGAAGCTGAGCATGAGG - Intergenic
1145958979 17:28874804-28874826 CAGTGTGGAAGGGGACCTAGCGG + Intergenic
1148329472 17:46804952-46804974 CAGCATGGAAGGCGACCCAAGGG - Intronic
1150693627 17:67385494-67385516 CAGCCTGGAAGGTGCCTGGGGGG - Intronic
1151308481 17:73279157-73279179 CAGCCTGGGAGGTGAGGGACAGG - Intergenic
1151549492 17:74813929-74813951 CTGGCTGGAAGGAGACGGAGCGG - Intronic
1152365803 17:79855658-79855680 CAGCCTTGATGGTGACCCTGGGG + Intergenic
1152479197 17:80538625-80538647 CAGGCTGGAAGGCCACCCAGCGG + Intergenic
1152834561 17:82520497-82520519 CTGCCAGGAAGGGGACCGGGAGG - Intronic
1153323358 18:3794250-3794272 CAGCATGGAAGGTGACAGCTTGG + Intronic
1155573970 18:27225058-27225080 CAGTGTGGAAGGGGACCCAGTGG + Intergenic
1157620794 18:49016578-49016600 CAGCCTGGAAGGGGGCAGGGTGG + Intergenic
1158744138 18:60178275-60178297 CAGCATGGAAGGGGACCTAGAGG + Intergenic
1160505450 18:79423932-79423954 CACCCTGGAGGGTCACCCAGAGG - Intronic
1161667752 19:5587323-5587345 CGGACTGGAAGGTGGCGGAGTGG - Exonic
1162261943 19:9541018-9541040 CAGCGTGGAAGGGGACCCAAGGG + Intergenic
1164767832 19:30785178-30785200 CACCCTGCAAGGTGCCAGAGGGG - Intergenic
1164867733 19:31618901-31618923 CACTCTGGAAGGTGACCCACAGG + Intergenic
1165160865 19:33815107-33815129 CAGCCAGCATGGTTACCGAGTGG + Intronic
1165348813 19:35265799-35265821 CAATCTGGAAGGTGACCAGGTGG + Intronic
1166064429 19:40348714-40348736 CAGCCTGGAAGGTGCGTGTGGGG + Exonic
1166129907 19:40739938-40739960 CAGCCTGGAGGCTGACAGGGAGG - Exonic
1167082193 19:47284203-47284225 CAGCCTGGGTGGTGACAGCGAGG + Intergenic
1168638820 19:58017124-58017146 CACCCTGGAAACTGACCTAGAGG + Intergenic
925247959 2:2401539-2401561 CAGACAGGAAGGTGCCCCAGAGG + Intergenic
926715966 2:15923706-15923728 CAGCTTGGGAGGTGACTGGGAGG + Intergenic
930035541 2:47083143-47083165 CAGCCTGGGAGGAGGCCGTGGGG - Intronic
931586405 2:63834613-63834635 CTTCCTGGAAGGTGGCCAAGAGG + Intergenic
932586442 2:73032680-73032702 CAGCTTGGAAGGAGGCAGAGGGG - Intronic
933581108 2:84128071-84128093 CAGCCTGGAAGGGGACCTGCTGG - Intergenic
934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
935640451 2:105285052-105285074 CATGCTGGACGGTGACGGAGTGG - Intronic
936502663 2:113078375-113078397 CAGCATGGAAGCTGACCCCGGGG - Intergenic
937094235 2:119225111-119225133 AAGCCTTGCAGGTGACTGAGAGG - Intronic
938946210 2:136214282-136214304 CAGCCTGAAAAGTGACAAAGGGG - Intergenic
939760135 2:146165506-146165528 CATGGTGGAAGGTGAACGAGGGG + Intergenic
941714124 2:168745926-168745948 GGGCCTGGGAGGTGACCCAGAGG - Intronic
942725795 2:179006092-179006114 CAGCCTTGAAGCTGCCTGAGAGG - Intronic
948449002 2:238057575-238057597 CAGCGTGGAAGGGACCCGAGCGG + Intronic
1169499106 20:6142016-6142038 TGGCCTGAAAGGTGGCCGAGGGG + Intergenic
1171726827 20:28631002-28631024 CACCCTGGAAGGTGACAAGGAGG + Intergenic
1175658204 20:60790290-60790312 CAGCGTGGAAGGGGACGGACTGG + Intergenic
1177715920 21:24840006-24840028 CAGCATGGAAGGTGACCCGAGGG + Intergenic
1178718233 21:34986209-34986231 CAGACTGGAAGGTGAAACAGTGG - Intronic
1180114528 21:45691294-45691316 CAGACTGGAAGGTGAGAGTGGGG + Intronic
1181114509 22:20622789-20622811 CAGCCTGGATGGTGTCCTTGTGG - Intergenic
1182392970 22:30014837-30014859 CAGCCTGGAGGCTGAGCAAGGGG - Intronic
1183324101 22:37182162-37182184 CAGCCGGGAGGGTGGCCCAGAGG + Exonic
1184857297 22:47153447-47153469 CAGCATGGGCGGTGACCCAGGGG + Intronic
1184899942 22:47439757-47439779 CAGCGTGGAAGCTGACTGTGTGG + Intergenic
1185325758 22:50225179-50225201 CACCCTGGAAGGAAACCAAGAGG + Intronic
1185345870 22:50310349-50310371 CAGCCGGGAGGGTGACCAAGGGG - Exonic
949887781 3:8710068-8710090 CAGCCTGCAAGGTGGGAGAGGGG + Intronic
951521097 3:23611513-23611535 GAGGCTGGGAGGTCACCGAGGGG - Intergenic
954288659 3:49637310-49637332 CAGCCATGGAGGTGACCGTGAGG + Intronic
958419998 3:93918371-93918393 CAGTGTGGAAGGGGACCCAGTGG - Intronic
959646928 3:108713695-108713717 CAGCCTTGAGGGTGAAGGAGGGG + Intergenic
964991118 3:162813739-162813761 CAGCTTGCTAGGCGACCGAGAGG + Intergenic
970089402 4:12387894-12387916 CAGTCTGGAAGTTGATTGAGGGG + Intergenic
971374435 4:26045473-26045495 CAGGCTGAAAGGTGACTGTGGGG - Intergenic
972530310 4:39955632-39955654 CACTCTGGAAGGTGACTGAGGGG + Intronic
975184342 4:71383898-71383920 CTGACTGGAAGGCGACAGAGCGG - Intronic
978144759 4:105359369-105359391 CAGCCTGGAAGGGGACCCACAGG - Intergenic
982921407 4:161278075-161278097 CAGTGTGGAAGGGGACCCAGGGG - Intergenic
983330342 4:166319304-166319326 CAGTCTGGAAGGTCACAGGGAGG - Intergenic
986259965 5:6135191-6135213 CGGCCTGGAAGATCACAGAGGGG + Intergenic
987128735 5:14840835-14840857 CATCCTGGAAGGTGACTGCAAGG + Intronic
990512014 5:56498197-56498219 CAACATGGAAGGGGACCCAGTGG + Intergenic
990622510 5:57576131-57576153 CAGAGTGGAAGGTGAAGGAGAGG - Intergenic
991707274 5:69369793-69369815 CAGTCTGGAAGGTCCCCGGGAGG + Exonic
996815716 5:127570416-127570438 CAGTGTGGAAGGTGACCTAGCGG - Intergenic
998676791 5:144418256-144418278 CAGCGTGGAAGGAGACCGAGTGG + Intronic
999323424 5:150628419-150628441 CAGCCAGGAAGGGAACCCAGAGG - Intronic
1001770948 5:174295404-174295426 CAGTGTGGAAGGTGCCGGAGTGG + Intergenic
1002740437 5:181431558-181431580 CAGTCTGGAAGGGGAACCAGAGG - Intergenic
1006221250 6:32493946-32493968 CAGCGTGGAAGGGGACCCACAGG - Intergenic
1006319744 6:33313454-33313476 CAGCCTGGAGGGCGCCCGCGGGG + Exonic
1006983105 6:38161484-38161506 CAGCCACGAAGGTGAACGTGTGG + Intergenic
1007734603 6:43972714-43972736 CAGCCTGGAAGATGTAGGAGAGG + Intergenic
1010649673 6:78437664-78437686 CAGCCTGGGAGGGGAAAGAGGGG - Intergenic
1016067233 6:139697445-139697467 CAGTGTGGAAGGGGACCCAGCGG + Intergenic
1018133360 6:160753412-160753434 CAGGCTGCAAGGTCACAGAGGGG + Intergenic
1018949589 6:168370567-168370589 CAGCCTGGACGCAGACCCAGAGG - Intergenic
1019245548 6:170707162-170707184 CAGTCTGGAAGGGGAACCAGAGG - Intergenic
1020407072 7:7848656-7848678 TTGCCTGGAAGGTGACACAGGGG + Intronic
1021347873 7:19549573-19549595 CAGCATGGAAGGGGACCCAAGGG + Intergenic
1022501902 7:30887155-30887177 CAGCATGGAAGCTGAACGGGAGG - Intronic
1023151420 7:37204564-37204586 CAGCATGGAAGGCGACCCAAAGG + Intronic
1023842634 7:44105674-44105696 AAGCCTGGAAGGAGAGCCAGAGG - Intronic
1024945451 7:54803453-54803475 CTGCCTGGAAGGTGGCATAGTGG + Intergenic
1026131818 7:67627245-67627267 CAGCCTGGAAGCTACCTGAGAGG + Intergenic
1026236818 7:68534554-68534576 CAGCGTGGAAGGAGACCGGCGGG + Intergenic
1029141969 7:98417695-98417717 CAGCCTTGAAGGGGAAGGAGGGG - Intergenic
1029458376 7:100682310-100682332 CAGCCTGGACGGTGGGCGAGCGG - Exonic
1031732399 7:125315148-125315170 CAGCATGGAAGGGGACCCAGTGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033220958 7:139525875-139525897 CAAGCTGGAAGGTCACCCAGAGG + Intronic
1034439373 7:151078830-151078852 CAGCCTGGCAGGTGCTGGAGGGG - Exonic
1035209896 7:157319984-157320006 TAGCCTGGAAGGTCACCCCGAGG + Intergenic
1035502577 8:101043-101065 CAGTCTGGAAGGGGAACCAGAGG + Intergenic
1036221058 8:6922007-6922029 CAGCCTGGATGGTGAAGGAGAGG - Intergenic
1036915110 8:12797061-12797083 CAGCGTGGAAGGGGACCGGAGGG - Intergenic
1041166339 8:55096359-55096381 CCGCCTTGAAGGTGGCCTAGAGG - Intergenic
1043395187 8:79828585-79828607 CAGCCTGGGAGGAGACCGGCAGG - Intergenic
1044621064 8:94191065-94191087 CAGCTAGGAAGGTGGCCAAGTGG + Intronic
1045096346 8:98801371-98801393 CAGTGTGGAAGGGGACCGAGCGG - Intronic
1048866837 8:138767705-138767727 CAGCCAGGATGGAGACCGGGCGG - Intronic
1049743633 8:144253328-144253350 CAGCGTGGAAGTGGACGGAGCGG - Intronic
1057279230 9:93698340-93698362 CAGCCGGGAGGGGGACAGAGTGG - Intergenic
1059343050 9:113610364-113610386 CACTCTGGAAGGAGACAGAGAGG - Intergenic
1060191035 9:121592880-121592902 CAGACTGGAGGGTGCCAGAGCGG + Intronic
1061731669 9:132619492-132619514 CAGCCTTAAAGGTGAAAGAGAGG - Intronic
1062539550 9:137035541-137035563 GAGCCTGGCAGGTGGCCAAGGGG + Exonic
1203605746 Un_KI270748v1:56366-56388 CAGTCTGGAAGGGGAACCAGAGG - Intergenic
1186442057 X:9595009-9595031 CAGACTGGTAGTTGACCCAGCGG - Intronic
1187353056 X:18540212-18540234 CAGGCTGGAGGGTCACCCAGTGG + Intronic
1187450227 X:19389443-19389465 CAGCCTGGCAGGAGAGCCAGAGG - Intronic
1190335511 X:49259398-49259420 CAGCATGGCAAGTGACAGAGAGG + Intronic
1192230275 X:69259871-69259893 CAGTCTGGAGGGTGACCCACTGG - Intergenic
1194482025 X:94438619-94438641 CAGGCTGGAAGAGGACTGAGTGG + Intergenic
1196142011 X:112273671-112273693 CTGCCTGGAAGGTAGCAGAGTGG + Intergenic
1197929779 X:131682297-131682319 CAGCTTGGAAGGTGAGAGACTGG + Intergenic
1198318683 X:135496555-135496577 CAGACTGGAAGTTAACCGATAGG + Intergenic
1201771752 Y:17622673-17622695 CAGCCTTCAGGGTGACTGAGAGG + Intergenic
1201829803 Y:18283313-18283335 CAGCCTTCAGGGTGACTGAGAGG - Intergenic