ID: 1080728663

View in Genome Browser
Species Human (GRCh38)
Location 11:34923837-34923859
Sequence GTGAATAGTATGAGCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080728661_1080728663 2 Left 1080728661 11:34923812-34923834 CCTGATTTGGCTTTTAGCTTTGG 0: 1
1: 0
2: 6
3: 53
4: 411
Right 1080728663 11:34923837-34923859 GTGAATAGTATGAGCACTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080728663 Original CRISPR GTGAATAGTATGAGCACTGA AGG Intronic
901470288 1:9451281-9451303 GTGAATATTATGAGATCTGATGG - Intergenic
902038240 1:13473259-13473281 GGGAGCAGTATGTGCACTGAGGG + Intergenic
903230513 1:21919556-21919578 GGGAAGAGTATGAGCATTGATGG + Intronic
904933500 1:34109285-34109307 TTGAATTGTATGAGCACTGATGG + Intronic
907099480 1:51815713-51815735 ATGAATAGTATGAGAATGGAAGG - Intronic
908578026 1:65482489-65482511 GTGACTGGTATGAGGACTAAGGG + Intronic
911499839 1:98672318-98672340 GAAAATAATATGAGCACTGGTGG + Intronic
921261103 1:213385813-213385835 GTGAACAGTAGCAGCACTGAAGG - Intergenic
921321849 1:213948704-213948726 GTGTATAGTATGAGTCCAGATGG + Intergenic
924950632 1:248879482-248879504 GAGAATAGTTTGAGCCCGGAAGG - Intergenic
1063271119 10:4510648-4510670 GAGAATCCTATGAGCCCTGACGG - Intergenic
1063816606 10:9782142-9782164 GTGAATAGTTGGAACTCTGATGG - Intergenic
1063982009 10:11461549-11461571 ATGAGTACTGTGAGCACTGAGGG + Exonic
1068171293 10:53397596-53397618 GTGAATAAAATGAGCATTGGAGG + Intergenic
1076569818 10:131425334-131425356 GAGAATAGTATGAGAGTTGAAGG - Intergenic
1080728663 11:34923837-34923859 GTGAATAGTATGAGCACTGAAGG + Intronic
1080930546 11:36805497-36805519 GAGAAGAGAATGAGAACTGAAGG + Intergenic
1090333573 11:125948538-125948560 GTGAACAGGCTGAGCAGTGACGG + Intergenic
1090688035 11:129147252-129147274 GTGAATTGTCTAAGCACTTATGG - Intronic
1091615140 12:2045109-2045131 GTGAATAGAATGAGGGTTGATGG + Intronic
1093418238 12:18945399-18945421 GAGAATAGTTTGAGCTCAGAAGG - Intergenic
1095372801 12:41489558-41489580 GTGTTTAGTATAAGCAATGAGGG + Intronic
1095387064 12:41662935-41662957 GAGAATGGTGTGAACACTGAAGG + Intergenic
1096841840 12:54384675-54384697 GTGTACACTATGTGCACTGAGGG - Intronic
1097014016 12:55972710-55972732 GTTAATAGCAAGAGCACTCAAGG - Exonic
1098736553 12:74112514-74112536 GTGAACACTGTGAGCACTGGTGG - Intergenic
1100346943 12:93741915-93741937 GAGCATAGAATGAGCACTAAGGG - Intronic
1101590637 12:106122163-106122185 GTGGATGTTATGAGCACTGTTGG - Intronic
1107733510 13:43372200-43372222 GTGAATAGTAAGAGCCATGAGGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109158943 13:58948336-58948358 GTGAGTATTATGAGATCTGACGG + Intergenic
1109852748 13:68088679-68088701 GTGAATATCATGAGATCTGATGG - Intergenic
1110806264 13:79757667-79757689 GTGAATACCATGAGATCTGATGG - Intergenic
1115742828 14:36406096-36406118 GAGAGGAGTATGAGCACTGCAGG + Intergenic
1120389269 14:83885147-83885169 GTGAACAGCATGAGAACTGGAGG + Intergenic
1124855404 15:33382797-33382819 GTTAATAGTAGGAGCCCTGGGGG + Intronic
1128803545 15:70513691-70513713 GTTACTTGTATGAGCACTTAGGG - Intergenic
1133322932 16:4925378-4925400 ATGAATAGTAACAACACTGAGGG + Intronic
1133855649 16:9546905-9546927 GGGCAAAGTATGAGCACTGAAGG + Intergenic
1135481776 16:22826665-22826687 GTGAATACTCTTAGCAATGAGGG + Intronic
1139115372 16:63944903-63944925 GGGACTAATATGAGCACTGGAGG - Intergenic
1148728730 17:49816899-49816921 GAGAATCGCTTGAGCACTGAAGG - Intronic
1148955224 17:51348056-51348078 TTGAAAAGTATGAGCAATGCTGG + Intergenic
1151130720 17:71893761-71893783 GTGAATAATATGAGCACCCTTGG + Intergenic
1154347025 18:13550964-13550986 GTGATGAGAATGAGCACAGAGGG - Intronic
928268573 2:29833543-29833565 GTGATTATTCTGGGCACTGAAGG - Intronic
929326399 2:40616567-40616589 GTGGATTGTATGAGAAATGAGGG - Intergenic
933464254 2:82631566-82631588 ATGAATAGTATGTGCAATAAGGG + Intergenic
937513499 2:122626397-122626419 GTGAATAAAGTGAGCACTGGTGG + Intergenic
937844115 2:126558454-126558476 GTGAACAGGCTTAGCACTGAAGG + Intergenic
938604483 2:132878115-132878137 GTGATTGGTGTGAGCCCTGATGG + Intronic
938607826 2:132914668-132914690 CTGAATTCTATGACCACTGAAGG + Intronic
944171870 2:196788109-196788131 TGGAATACAATGAGCACTGAGGG - Intronic
1169638942 20:7726608-7726630 GTGTATAGTATAAGGAGTGATGG + Intergenic
1170357006 20:15503893-15503915 AAGAAAAGCATGAGCACTGATGG - Intronic
1174058677 20:47817126-47817148 GAGAAAGGTATGAGCAGTGACGG - Intergenic
1178522073 21:33294793-33294815 GTGAAGATTAAGAGCACTGGTGG + Intronic
1178776521 21:35556604-35556626 GAGAATAGTTACAGCACTGAAGG - Intronic
1179113231 21:38465410-38465432 GTGAACAGGTGGAGCACTGAGGG + Intronic
1179300468 21:40104558-40104580 ATGAATAGGAGGAGCACAGAGGG + Intronic
950285794 3:11743749-11743771 CTGTATAGTGGGAGCACTGAGGG - Intergenic
950566912 3:13774878-13774900 GTGAATTGTTAGAACACTGAGGG - Intergenic
950635294 3:14310070-14310092 ATGAATAGGCTGAGCACAGAGGG + Intergenic
952004389 3:28825718-28825740 GTAAATAGTAGGTGAACTGAAGG - Intergenic
956346913 3:68289719-68289741 ATGAATAGAATGAGGAATGAGGG + Intronic
959136044 3:102422549-102422571 GTGAATTCTATGAGCACGAAGGG + Intronic
964773798 3:160253816-160253838 ATGAATAAAATGGGCACTGATGG + Intronic
965682249 3:171263655-171263677 GTGAATAGTAAGTTCAGTGAAGG + Intronic
965682318 3:171264229-171264251 GTGAATAGTAAGTTCAGTGAGGG - Intronic
972139739 4:35943179-35943201 GTGCATATTATAAGCACTGGAGG + Intergenic
972235618 4:37130712-37130734 GATAATAGTATGGGCCCTGAAGG - Intergenic
978211052 4:106135492-106135514 GTGCATACTATGAGAACTCAGGG + Intronic
986512864 5:8526708-8526730 GTGTATAGTATGAACAGTGTAGG + Intergenic
990040523 5:51373680-51373702 GTGAATGTCATGAGAACTGAGGG + Intergenic
990567750 5:57046894-57046916 GTGTTTTGTATGTGCACTGATGG + Intergenic
993797835 5:92291002-92291024 GTGTATAGAATCAGCAGTGACGG + Intergenic
998845905 5:146309763-146309785 GAGAATCGTATGAGCACGGGAGG - Intronic
1006020570 6:31115367-31115389 GGGAATCATCTGAGCACTGAGGG + Exonic
1008279699 6:49582215-49582237 GAGGATTGTTTGAGCACTGAAGG - Intergenic
1008760159 6:54844424-54844446 GTGAATAGTATGACAAGGGAAGG - Intergenic
1009958119 6:70481541-70481563 GTGAATCGCTTGAGCACAGAAGG + Intronic
1016010130 6:139130682-139130704 GACAATAGTATGAGCAAGGAAGG + Intergenic
1016480077 6:144471171-144471193 GTGAATTGCATGTGCCCTGATGG + Intronic
1016892050 6:149016560-149016582 GTGAACAGTCTGTGCTCTGAGGG + Intronic
1018200479 6:161390218-161390240 GTGCGTAGTGTGAGAACTGAAGG - Intronic
1019980952 7:4621677-4621699 GTGGATAGTATGTGCAGTGTGGG - Intergenic
1022355053 7:29606814-29606836 GTGAATAGAATGAGGACTCATGG - Intergenic
1022713510 7:32875359-32875381 GAGAATCGTTTGAGCACAGAAGG - Intronic
1024484554 7:49903554-49903576 GAGAATATTATCAGCCCTGAGGG + Intronic
1026403052 7:70035824-70035846 ATGAATAGAAGGAGCATTGAAGG - Intronic
1028590305 7:92485972-92485994 TTGATTAGTATAAGCACTGAAGG - Intergenic
1028718933 7:94006956-94006978 GGGAATATTACTAGCACTGATGG + Intergenic
1031893116 7:127318275-127318297 GAGAATAGTAGGAGGACAGAAGG + Intergenic
1032946121 7:136854944-136854966 GTGAATGGTATGACCACTTCAGG + Intergenic
1039821111 8:41136414-41136436 ATGAATAGCATGAGCAGTGCTGG - Intergenic
1041678635 8:60563445-60563467 GTGATTCATATGGGCACTGAAGG + Intronic
1042174068 8:66021729-66021751 AAGAATAGTATAAGCACAGACGG + Intronic
1043475817 8:80605274-80605296 GTGAAGAAGATGAGCACTGCAGG - Intergenic
1044691041 8:94878741-94878763 GAGAAAAGTAAGAGCAGTGATGG - Intronic
1044956817 8:97489875-97489897 ATGAATAGGAGGAGCACAGAGGG + Intergenic
1049598595 8:143496694-143496716 GGGAAAAGTGTGAGGACTGAGGG - Intronic
1052236484 9:26217252-26217274 GTGAATAGTATGACCAGTTTTGG - Intergenic
1052520546 9:29542917-29542939 GTTAATAATAGGAGAACTGAGGG - Intergenic
1059041800 9:110822897-110822919 GAGAATGGTATGAACACTGGAGG - Intergenic
1062457746 9:136647373-136647395 GTGGGAAGTGTGAGCACTGAGGG - Intergenic
1186341307 X:8649130-8649152 GTGAATACTCTGGGCACTAAAGG - Intronic
1192184473 X:68937422-68937444 GTTAATAATAATAGCACTGATGG + Intergenic
1193532913 X:82678113-82678135 GAGAATAGTTTGAGCCCTGGAGG - Intergenic
1193749813 X:85327476-85327498 GTGAGTAGAAAGAGAACTGAAGG + Intronic
1194460336 X:94159011-94159033 GTGAAGAGTATGAGAATAGAAGG + Intergenic
1196567998 X:117230956-117230978 GTGAATCTTATGAGATCTGATGG - Intergenic
1198004849 X:132482530-132482552 GAGACCAGTATGAGCAGTGAAGG - Intronic
1199070183 X:143467415-143467437 GTGAGTCGTATGAGATCTGATGG - Intergenic