ID: 1080729847

View in Genome Browser
Species Human (GRCh38)
Location 11:34938141-34938163
Sequence GTGAACAGAAGGACGACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080729844_1080729847 26 Left 1080729844 11:34938092-34938114 CCTCAAGGGTGGGCTGAAGTGTG 0: 1
1: 2
2: 1
3: 27
4: 155
Right 1080729847 11:34938141-34938163 GTGAACAGAAGGACGACTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080729847 Original CRISPR GTGAACAGAAGGACGACTAG AGG Intronic
902172844 1:14627067-14627089 GTGAACAGACAGACCAGTAGGGG + Intronic
907391842 1:54163264-54163286 GTGAACAGTAGGAGGCCCAGGGG - Intronic
908230797 1:62103041-62103063 GTGAACAAAAAGATGACTTGTGG - Intronic
918646133 1:186907284-186907306 GGGAATAGATGTACGACTAGAGG - Intronic
919023446 1:192137647-192137669 GTGAACACATGGACGCATAGAGG + Intergenic
923165910 1:231361491-231361513 AGGAACAGAAGGAAGACCAGGGG + Intergenic
1066437750 10:35409502-35409524 GTGAACAGAAAAAAGACTGGAGG + Intronic
1068437348 10:57009700-57009722 GTGAAATGAGGGATGACTAGGGG - Intergenic
1071862191 10:89685659-89685681 GTGAACAGAGGGGAGACCAGCGG + Intergenic
1074918579 10:117983307-117983329 GGTAACTGAAGGATGACTAGTGG - Intergenic
1076179086 10:128392040-128392062 GTGATCAGAAAGACGATAAGAGG - Intergenic
1077277890 11:1725049-1725071 GAGAACAGAAGGATAACTACAGG + Intergenic
1080729847 11:34938141-34938163 GTGAACAGAAGGACGACTAGAGG + Intronic
1082264951 11:50108294-50108316 GTGGGCAGAAGGAGGACTGGAGG - Intergenic
1084255604 11:67940455-67940477 ATGAACAGAAGGACAAGCAGTGG + Intergenic
1084817143 11:71654850-71654872 ATGAACAGAAGGACAAGCAGTGG - Intergenic
1086254068 11:84853713-84853735 GTGAGAAGAAGGAAGACTAGGGG - Intronic
1092331008 12:7588207-7588229 GTGAACAGAATGTAGACGAGGGG + Intergenic
1092425839 12:8375189-8375211 ATGAACAGAAGGACAAGCAGTGG + Intergenic
1098332758 12:69372028-69372050 GTGAACAAGAGGACGAGGAGTGG + Intronic
1099842253 12:87980895-87980917 GTGGACAGATGGACTACTGGAGG - Intronic
1102549554 12:113681854-113681876 GTGAATAGAAGTCAGACTAGCGG + Intergenic
1103286932 12:119810247-119810269 CTGAACTGGAGGACGCCTAGTGG + Intronic
1107223799 13:38021290-38021312 ATGAACAAAAGGACAACCAGGGG - Intergenic
1109070535 13:57760809-57760831 GTGAACAGAAGTACCCGTAGAGG - Intergenic
1109192638 13:59344065-59344087 GTGAACAAAAGGGAGACTAAAGG + Intergenic
1109926063 13:69140801-69140823 GTGAACAGTATTACAACTAGAGG - Intergenic
1112996923 13:105585717-105585739 GTGAACAGAAGGACTCTAAGAGG + Intergenic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1119635269 14:76268238-76268260 ATGAACAGAAGGACGGCTGTGGG - Intergenic
1119700900 14:76753896-76753918 GTGCACTGTAGGACGGCTAGTGG - Intergenic
1125460329 15:39900615-39900637 GTGATCAGAAGGACCAATTGAGG - Intronic
1126428169 15:48551710-48551732 GAGAACAGATGGACGCATAGAGG - Intronic
1126907705 15:53385396-53385418 GTGAAGATAAGGACGACAACCGG + Intergenic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1137368625 16:47883601-47883623 GTGAACAGAGGGATGAATGGTGG - Intergenic
1139212834 16:65097492-65097514 GTGCACTGCAGGACGTCTAGCGG + Intronic
1140312540 16:73863386-73863408 GTGAACAGCAGGACGCCAAAAGG + Intergenic
1140660662 16:77189314-77189336 GTGAGCAGAGGGATGACTTGGGG - Intergenic
1140690065 16:77473770-77473792 GTGAACTAAAGGACAACTCGAGG + Intergenic
1142852406 17:2710662-2710684 GGGAACAGAAGGAAGAGAAGGGG + Intronic
1143128501 17:4660656-4660678 GAGAACAGAGAGAGGACTAGTGG + Intergenic
1143568654 17:7740666-7740688 GGGAACAGAAGAAAGACAAGAGG - Intronic
1146409226 17:32567754-32567776 GTGCACAGAAGGACACCTACAGG + Intronic
1147846851 17:43410548-43410570 GTGCACTGAAGGCTGACTAGGGG + Intergenic
1149857981 17:60101391-60101413 GTCTACAGAAGGACTTCTAGGGG + Intergenic
1150683723 17:67303613-67303635 GTGAAAAGAAGGATGATGAGGGG + Intergenic
1163263919 19:16207076-16207098 CTGAGCAGAAGGAGGACTTGAGG + Intronic
1166078153 19:40425824-40425846 GGGAACAGAAGGGCTACCAGCGG - Intronic
925943374 2:8839797-8839819 GAGGACAGAAGGAGGACTAGGGG - Intergenic
926165948 2:10522261-10522283 GTGGACAGAAGGACGCCCTGAGG - Intergenic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
928076584 2:28270616-28270638 GTGAACAGCAGGTCGACTCTTGG - Intronic
931250522 2:60527231-60527253 GGGAAGAGAAGGAAAACTAGGGG + Intronic
937379923 2:121367376-121367398 GTGAACAGAAGCACAAGTAGCGG - Intronic
939097297 2:137848494-137848516 GAGAACAGTAGCACCACTAGTGG + Intergenic
947049351 2:226024607-226024629 GTAGAAAGAAGGACGAGTAGAGG - Intergenic
949008102 2:241661758-241661780 GTGGACAGAAGGATGAGTTGCGG - Intronic
1169691385 20:8336136-8336158 GTCAACAGAATGAAGACTAAAGG + Intronic
1171236772 20:23533651-23533673 TTGAACAGAAGGGCTGCTAGGGG + Intergenic
1172984761 20:38975842-38975864 GTGAACAGAAGGCCCACTTTTGG - Intronic
1178452535 21:32716783-32716805 GTGAACTGCAGGACGACTTCCGG - Intronic
1178635695 21:34300524-34300546 GAGAAAAGAAGGTAGACTAGAGG - Intergenic
949893855 3:8754464-8754486 GCAGACAGAAGGAAGACTAGTGG - Intronic
950750932 3:15127310-15127332 ATGAACAGAAGGACAAGCAGTGG - Intergenic
952932301 3:38369637-38369659 GTGACCAGAAGGAAGTTTAGAGG + Intronic
957491667 3:80934894-80934916 GGGAACAGAAGGAAGAATTGTGG + Intergenic
965492857 3:169361217-169361239 GTGCACAGGAGGAGGACTAGGGG - Intronic
969014132 4:4092155-4092177 ATGAACAGAAGGACAAGCAGTGG + Intergenic
969301156 4:6298155-6298177 GCGAACAGCAGGACAACTAAAGG - Intronic
970495355 4:16619337-16619359 CTCAGCAGAAGGACCACTAGGGG - Intronic
975178872 4:71320315-71320337 GGGACCAGAAGGAAGACTTGAGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978927861 4:114271340-114271362 GTCAACAGAAAGACAACCAGTGG + Intergenic
981281980 4:142969054-142969076 GTGAGCAGAAGGATGACTTTAGG + Intergenic
990764926 5:59171373-59171395 TTGAAAAGAAGAAAGACTAGGGG - Intronic
994220241 5:97187181-97187203 GTGAACACAAGCAGGACCAGAGG + Intergenic
997825508 5:137103414-137103436 GTAAACAGAAGTAACACTAGTGG + Intronic
999001561 5:147929343-147929365 GAGCACAGAAGGAAGATTAGAGG + Intergenic
1003348354 6:5292519-5292541 TTGAAGAGAAGGAAGACTAAAGG + Intronic
1006660934 6:35643660-35643682 GTGACCAGAAGAATGACTATGGG - Intronic
1007089039 6:39170457-39170479 GTGGACAGATGGACTCCTAGAGG + Intergenic
1009472833 6:64049306-64049328 GTGAAGAGATGGATGAATAGAGG - Intronic
1016441413 6:144087984-144088006 GTGATAAGAGGGACGCCTAGAGG + Intergenic
1020047967 7:5057653-5057675 GGGAAAAGAAGGAGGACTTGGGG - Intronic
1020661019 7:10982720-10982742 GTTAACAGCAGGAGGACTTGTGG - Exonic
1021213665 7:17888377-17888399 GTGAAAAGAAAGGTGACTAGGGG + Intronic
1022553813 7:31271271-31271293 GTTAACAGAGGGAGGACCAGAGG + Intergenic
1029072790 7:97913785-97913807 ATGAACAGAAGGACAAGCAGTGG + Intergenic
1033740654 7:144273176-144273198 TTGAACAGAAGGACTAGTATCGG - Intergenic
1033753253 7:144376437-144376459 TTGAACAGAAGGACTAGTATCGG + Intronic
1036244881 8:7107512-7107534 ATGAACAGAAGGACAAGCAGTGG - Intergenic
1036896942 8:12643944-12643966 ATGAACAGAAGGACAAGCAGTGG + Intergenic
1041029625 8:53723683-53723705 GTGAACAGAAGGAGGAAGTGTGG - Intronic
1041748956 8:61238263-61238285 ATGGACAGAAGGAAGGCTAGAGG - Intronic
1041903797 8:63009815-63009837 GTGTTCAGAAGGGTGACTAGGGG - Intergenic
1042360677 8:67879171-67879193 GGGAAAAGAAAGACGAATAGTGG + Intergenic
1043219417 8:77640537-77640559 GAGAACTGAAGGACGAAAAGGGG + Intergenic
1047318630 8:123757405-123757427 ATGAACAGAAGGACAAATACTGG + Intergenic
1050384539 9:5073385-5073407 GAGGACAGAAGTACAACTAGAGG - Intronic
1053462830 9:38284013-38284035 GTGAACAAAAGTCAGACTAGTGG + Intergenic
1055188678 9:73490599-73490621 GGGAACAGAAGGATGACCTGTGG - Intergenic
1055296236 9:74836644-74836666 TTGAACAGCAGGATGAATAGGGG - Intronic
1056839951 9:89990441-89990463 GTGAACAGGAGGACAAGGAGAGG - Intergenic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1185924234 X:4128657-4128679 GGGAACAGAAGGAAGACAAATGG - Intergenic
1185959569 X:4534089-4534111 GTGAACAGAAAGCAGACTGGAGG + Intergenic
1187065416 X:15832162-15832184 GTCTACAGAAGGACTTCTAGGGG + Intronic
1191665705 X:63700403-63700425 GTGAACAGAGGGTAGATTAGGGG + Intronic
1194325679 X:92513913-92513935 ATGAACAGAAAGCAGACTAGTGG - Intronic
1196064181 X:111444531-111444553 GTGACAAGAAGCAAGACTAGGGG + Intergenic
1196433665 X:115654753-115654775 GGGAACAGAAGGACAAAAAGTGG - Intergenic
1198960564 X:142177932-142177954 GTGAACACAAGGACACGTAGAGG - Intergenic
1200634408 Y:5633080-5633102 ATGAACAGAAAGCAGACTAGTGG - Intronic