ID: 1080730099

View in Genome Browser
Species Human (GRCh38)
Location 11:34941825-34941847
Sequence CAGGACGATGATGCTGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080730097_1080730099 -7 Left 1080730097 11:34941809-34941831 CCATCGGACAAAGGAACAGGACG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 86
1080730092_1080730099 12 Left 1080730092 11:34941790-34941812 CCTCAGCTCTGGCAGCTGCCCAT 0: 1
1: 1
2: 3
3: 96
4: 683
Right 1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 86
1080730090_1080730099 26 Left 1080730090 11:34941776-34941798 CCGTATACTTCAGTCCTCAGCTC 0: 1
1: 0
2: 0
3: 20
4: 205
Right 1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 86
1080730089_1080730099 29 Left 1080730089 11:34941773-34941795 CCTCCGTATACTTCAGTCCTCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 86
1080730096_1080730099 -6 Left 1080730096 11:34941808-34941830 CCCATCGGACAAAGGAACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080730099 Original CRISPR CAGGACGATGATGCTGGCGT CGG Intronic
901852046 1:12022004-12022026 CAGGATGAGGATGCTTGCCTTGG + Intronic
906847325 1:49207176-49207198 CAGGATGATGATCCTGTCATTGG + Intronic
914858691 1:151369884-151369906 CAGAGCGATGAGGCTGGAGTGGG - Exonic
921893697 1:220377906-220377928 CAGGACCAGGATGCTGGCCCAGG - Intergenic
922229095 1:223670195-223670217 CAGGAGGTTGAGGCTGCCGTGGG + Intergenic
924813588 1:247424151-247424173 CAGGAAGATGATGTTGGACTGGG + Exonic
1064064029 10:12165099-12165121 CAGCACGATGATGCTGTCACTGG - Intronic
1067142802 10:43670534-43670556 CAGGACGAAGACGCCTGCGTGGG - Intergenic
1067760190 10:49039205-49039227 CGGGAGGATGAGGCAGGCGTAGG + Intronic
1068681037 10:59820222-59820244 GAGGACTACGATGCTGGGGTGGG + Intronic
1072307676 10:94122900-94122922 GAGGAGGATGATGCTGGTCTGGG + Intronic
1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG + Intronic
1092776120 12:11946474-11946496 CAGGAGGATGGTGGTGGCATTGG - Intergenic
1102326060 12:111985659-111985681 CAGGAGGTTGAGGCTGCCGTGGG - Intronic
1102965001 12:117119010-117119032 CTGGACGCTGAGGCAGGCGTGGG - Intergenic
1102982867 12:117256146-117256168 GAGGACTAAGATGCTGGAGTTGG + Intronic
1104524307 12:129504161-129504183 CAGGATGATGATGATGGTGATGG - Intronic
1107651532 13:42549980-42550002 CAGAACAATCATGCTGGCTTGGG + Intergenic
1113259724 13:108548269-108548291 TAGGATGATGATGCTGGTGGTGG + Intergenic
1114701726 14:24685507-24685529 TAGGATGATGGTGCTGGCGATGG - Intergenic
1122393760 14:101408182-101408204 CAGGCAGATGAGGCTGGCGCAGG - Intergenic
1124030142 15:26003153-26003175 CAGGAAGATGATTCTGCCATAGG - Intergenic
1133144669 16:3775813-3775835 TAGGAAGATGCTGCTGGTGTGGG - Intronic
1136573305 16:31109217-31109239 CAAGACGATGATCCTGGCGTCGG + Exonic
1138476034 16:57271055-57271077 CAGGAGGACGATGCTGGAGGTGG + Intronic
1141880311 16:86854065-86854087 GAGGAAGATGATGATGGCGGTGG - Intergenic
1142005704 16:87688693-87688715 CAGGACGGGGATGCTGGGGGCGG + Intronic
1142485413 17:244554-244576 CAGGAAGAAGATGCTGGCCCCGG + Intronic
1145212891 17:21028168-21028190 GAGGTCGCTGAGGCTGGCGTGGG - Intronic
1146063019 17:29616947-29616969 CAGGTAGACGATGCTGGAGTCGG + Exonic
1146909094 17:36636760-36636782 CGGGAAGGTGATGCTGGGGTGGG + Intergenic
1147689029 17:42304283-42304305 CAGGACCATGCTCCTGGCCTGGG + Intronic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1151427509 17:74040625-74040647 GAGGATGATGTTGCTGGAGTTGG - Intergenic
1160171537 18:76559351-76559373 GAGGAGGCTGATCCTGGCGTGGG - Intergenic
1160453614 18:78980712-78980734 CAGGACGCTGAGGCCGGCGGCGG + Intronic
1163334444 19:16661537-16661559 CAGGACGATGAAGCTGGGGGAGG + Intronic
1168336701 19:55600936-55600958 CGGGAAGATGGTGGTGGCGTTGG + Intronic
925045001 2:766468-766490 CAGGACCATGGTGTTGGCCTTGG + Intergenic
925874206 2:8298125-8298147 GTGGATGGTGATGCTGGCGTAGG + Intergenic
930353908 2:50293164-50293186 CAGGACAATGAGGCAGGCTTGGG - Intronic
936404853 2:112193853-112193875 CAGAACAATGATGCTGATGTGGG + Intergenic
937213368 2:120292825-120292847 CAGTACGATGATTCTGTCCTTGG + Intronic
942400869 2:175601790-175601812 CAGGAAGATTATGGTGGCTTAGG - Intergenic
942469572 2:176245618-176245640 CAGGATGATGATGGTGGTGGTGG - Intergenic
1172644018 20:36458793-36458815 CAGGGTGATGATGGTGGCTTAGG + Intronic
1173813572 20:45971241-45971263 GAGGCCGATGACTCTGGCGTGGG - Exonic
1174092029 20:48057014-48057036 TAGGACGTTGATGCTGGATTGGG + Intergenic
1175440314 20:58986093-58986115 CAGGAGGATGATTCTGGAGAAGG + Exonic
1181395264 22:22616775-22616797 CAGGACGCTGCTGCTGGGGTGGG - Intergenic
1182453160 22:30433055-30433077 CAGGAAAATGGTGCTGGTGTTGG - Intergenic
1183284540 22:36953708-36953730 CAGGAAAATGGTGCTGGCCTGGG - Intergenic
1185324952 22:50221005-50221027 CCCGACCCTGATGCTGGCGTTGG + Exonic
954126977 3:48537038-48537060 CAGGAGGATGGTGCTGGTGGTGG + Intronic
959290100 3:104462992-104463014 CAGGAAGCTAATGCTGCCGTGGG + Intergenic
960949853 3:122992316-122992338 CAGGACGATGATGACAGCGTGGG + Intronic
961166024 3:124764520-124764542 CAGGAGGATGGTCATGGCGTTGG + Exonic
964404541 3:156335263-156335285 CAGGAGGAGGAAGCTGGAGTAGG - Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
969722874 4:8902774-8902796 CAGGAAAATGATGCTGGTGATGG - Intergenic
975592069 4:76010816-76010838 CAGGGAAATGATGCTGGCCTGGG - Intergenic
983392080 4:167145073-167145095 CAGGATGGTCATGCTGGAGTTGG + Intronic
986672076 5:10151215-10151237 CAGGAGGTTGAGGCTGGAGTGGG + Intergenic
987276514 5:16368820-16368842 GAACACGATGATGCTGGTGTTGG - Intergenic
987403506 5:17502133-17502155 CAGGACCAGGATGATGGCCTAGG + Intergenic
987410984 5:17614873-17614895 CAGGACGAGGATGATGGCCTGGG + Intergenic
995035659 5:107531396-107531418 CAGGACGGTGAGGCTGCCGAAGG + Intronic
995449077 5:112280659-112280681 GAGAAAGATGATGCTGACGTTGG + Intronic
999467696 5:151822944-151822966 CAGGAGGATGAAGCTGGAGAAGG - Exonic
1000157958 5:158570381-158570403 CAGAACGATGATGCTGTAGTTGG + Intergenic
1001926894 5:175644026-175644048 GAGGACGATGATGATGGTGATGG - Intergenic
1004166484 6:13261225-13261247 CTGGAGGAAGAGGCTGGCGTAGG + Intronic
1006181312 6:32154882-32154904 CAGGGAGCTGGTGCTGGCGTGGG + Intronic
1007708880 6:43808679-43808701 CAGGAGGTTGAGGCTGTCGTGGG + Intergenic
1008128953 6:47698807-47698829 CAGGAAAATGGTGCTGGTGTAGG - Intronic
1018335084 6:162778198-162778220 CAGCACGGTGATTGTGGCGTTGG + Intronic
1026974229 7:74486871-74486893 CAGGACACTGAGGGTGGCGTGGG + Intronic
1027241084 7:76329587-76329609 CAGGACGACGATGGCGGCGAAGG - Exonic
1030176725 7:106661284-106661306 CTGGAAGATGGTGCTGGGGTGGG + Intergenic
1032839020 7:135699378-135699400 CAGGAAGATGAGGCTGGTGGAGG + Exonic
1036048601 8:5170714-5170736 CTGGACGATGGTGCTGGTGAGGG + Intergenic
1037529493 8:19758776-19758798 CAGGACATGGAGGCTGGCGTTGG + Intergenic
1039469015 8:37802283-37802305 CAGGACAAGGATGCTGGTGGAGG + Intronic
1039877731 8:41602026-41602048 CAGGACGAGGAGGCTGCAGTGGG - Intronic
1043923976 8:86016044-86016066 CATGATGATGATGATGGCGATGG - Intronic
1053892712 9:42710808-42710830 CAGGTCGCTGCTGCTGGGGTGGG + Intergenic
1056186717 9:84142199-84142221 CAGCACCTTGATGCTGCCGTGGG + Intergenic
1057794093 9:98143353-98143375 CATGACTATGATGCTGTTGTAGG - Intronic
1059742023 9:117161166-117161188 CAGGATGATGATGATGGTGGTGG + Intronic
1188186550 X:27123471-27123493 CAGGACGATGAGTCTGTAGTTGG - Intergenic
1188532326 X:31155881-31155903 CAGGAGGAGGAGGCTGGGGTGGG + Intronic
1189848538 X:45157790-45157812 CATGAAGATGCTGCCGGCGTCGG + Exonic
1198774132 X:140161737-140161759 CATGATGATGATGATGGCGATGG - Intergenic