ID: 1080731124

View in Genome Browser
Species Human (GRCh38)
Location 11:34954363-34954385
Sequence CTGTGTACACAGATGAGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080731124 Original CRISPR CTGTGTACACAGATGAGATT AGG Intronic
901761953 1:11477599-11477621 CTCTGTACTCATATCAGATTTGG + Intergenic
902319417 1:15650362-15650384 CTGGGTATTTAGATGAGATTAGG + Intronic
903002701 1:20277613-20277635 TTGTGAAGACAGAAGAGATTAGG - Intergenic
903654259 1:24939505-24939527 CTGTTTACACAGCTGTGATGTGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG + Intergenic
912549705 1:110477408-110477430 CTCTGTGCACACCTGAGATTTGG - Intergenic
916591005 1:166190314-166190336 CTATGTACTCAAGTGAGATTGGG + Intergenic
916998211 1:170324994-170325016 CAGTGTTCACATATGAAATTTGG + Intergenic
917452820 1:175161335-175161357 CTATGTACACACATTATATTGGG + Intronic
919499542 1:198318838-198318860 CTGTGTACACAATTGAGGATTGG + Intronic
920494784 1:206447043-206447065 CTGTACAAAGAGATGAGATTGGG - Intronic
921582444 1:216910807-216910829 CTGTGTACATTGATAAGAATTGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063962514 10:11318768-11318790 CTGTGTACAGAGAAGGGAGTTGG + Intronic
1064434155 10:15296143-15296165 CTGTGTAATCTGATGAAATTAGG + Intronic
1065129503 10:22606406-22606428 CTGTGTACACAGAAGAGCTGAGG - Intronic
1067896310 10:50183701-50183723 CTGTGAACTCAAATGAGATGTGG + Exonic
1067952667 10:50758326-50758348 CTGTGAACTCAAATGAGATGTGG - Intronic
1068132471 10:52911842-52911864 CTTTGTAAACAGATTAGAGTTGG - Intergenic
1070120904 10:73575801-73575823 TTGACTACACAGATGATATTTGG - Intronic
1075192432 10:120322114-120322136 ATGTGTTCACAGAAGAGAATTGG - Intergenic
1078918904 11:15808445-15808467 CTGTGTAGATATTTGAGATTTGG + Intergenic
1079238819 11:18708023-18708045 CTGGTCACACAGATGATATTTGG + Intronic
1079682006 11:23309283-23309305 ATATGTATGCAGATGAGATTAGG + Intergenic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1083589387 11:63884290-63884312 CTCTGAAGACAGAGGAGATTTGG + Intronic
1090126356 11:124089075-124089097 CTGTGTTCAATGGTGAGATTTGG + Intergenic
1090340355 11:126013260-126013282 CTATGTTCATAAATGAGATTGGG + Intronic
1090867515 11:130714747-130714769 CTGTGAAAAGAGATGAGTTTAGG + Exonic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1093123289 12:15299254-15299276 CTGTGAAAAGACATGAGATTTGG - Intronic
1093707391 12:22289319-22289341 CTGTTTCCTCAGATGAGAATTGG - Intronic
1094241708 12:28234234-28234256 CTGTGTTCATAGAAAAGATTTGG - Intronic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097858688 12:64495099-64495121 CTGCCTACACAGTTGATATTTGG + Intronic
1099082263 12:78200072-78200094 CTGTCAACACAGTTTAGATTAGG + Intronic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1100946539 12:99789786-99789808 GTGTGTTTTCAGATGAGATTGGG - Intronic
1101012543 12:100466074-100466096 CTGTGATCACATTTGAGATTAGG + Intergenic
1102654626 12:114471515-114471537 CTGTCTACACAGAGGTGATTTGG + Intergenic
1107702458 13:43061689-43061711 CTCTGAATACAAATGAGATTTGG - Intronic
1107826775 13:44335685-44335707 GTGTGTACACAGATGGGCTCTGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108161198 13:47641674-47641696 TTTTATACACACATGAGATTTGG - Intergenic
1111163242 13:84422009-84422031 ATGTGAAAACACATGAGATTTGG + Intergenic
1111190525 13:84800876-84800898 CGGTGTACACAGAAGATATTGGG - Intergenic
1111727082 13:92025344-92025366 CTGTGTACACAGAAGTGTTTTGG - Intronic
1112464256 13:99629699-99629721 AAGTGGACACAGATGGGATTGGG + Intronic
1118533577 14:66732953-66732975 ATGTGAAAAGAGATGAGATTTGG + Intronic
1119484879 14:74980795-74980817 CTGTGTGCGCTGATGGGATTAGG - Intergenic
1120257657 14:82140808-82140830 TTGTTTATACAGATGAGCTTAGG - Intergenic
1121648995 14:95543036-95543058 CTGAGGACACACATGAGATGAGG - Intronic
1121909174 14:97773572-97773594 CAGTGTGCAAAGCTGAGATTTGG + Intergenic
1125336098 15:38627769-38627791 ATGTGCACACAGATAAGCTTGGG - Intergenic
1126174974 15:45727833-45727855 CAGAGTACACAGTTGACATTAGG - Intergenic
1126616006 15:50580721-50580743 CTCTTCACATAGATGAGATTAGG - Intronic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1128749409 15:70138353-70138375 CTGGGTACCCAGAAGAGGTTTGG + Intergenic
1130865050 15:87926118-87926140 ATGTGAACACAGGTAAGATTAGG + Intronic
1130988403 15:88859965-88859987 CTTTGTACACGGATGGGGTTGGG - Intronic
1131985913 15:98042814-98042836 GTGTGTAGATAGATGAGAGTGGG + Intergenic
1135246200 16:20859389-20859411 CTGTTTACATAGATGAATTTAGG - Exonic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1137990829 16:53153320-53153342 GTTTGTATACAGATGAGAATGGG + Intronic
1138851805 16:60638420-60638442 CTGTGTGTAGAGAAGAGATTAGG + Intergenic
1139891888 16:70258423-70258445 GTCTGTTCACATATGAGATTTGG - Intronic
1142404363 16:89879115-89879137 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404378 16:89879199-89879221 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404385 16:89879241-89879263 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404402 16:89879367-89879389 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404407 16:89879409-89879431 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404414 16:89879451-89879473 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404421 16:89879493-89879515 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404428 16:89879535-89879557 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404435 16:89879577-89879599 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404442 16:89879619-89879641 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404449 16:89879661-89879683 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404456 16:89879703-89879725 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404463 16:89879745-89879767 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404470 16:89879787-89879809 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404477 16:89879829-89879851 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404484 16:89879871-89879893 CCGTGTGCACAGATGGGCTTCGG + Intronic
1145070366 17:19800438-19800460 TTGTGTGCAAGGATGAGATTTGG + Intronic
1146518753 17:33509925-33509947 CTGTGTAAAAAGAAGAGTTTGGG + Intronic
1147494706 17:40904742-40904764 GTGTGTAGAGAGATGAGAATGGG + Intergenic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1149107482 17:52986626-52986648 TTGTGCACAGATATGAGATTGGG + Exonic
1153237329 18:3000596-3000618 CTGTGTACACTCATGATGTTGGG - Intronic
1157580357 18:48770645-48770667 CTGTCTAGAGAAATGAGATTCGG - Intronic
1158384487 18:56974177-56974199 ATATGTACACACATGAAATTAGG - Intronic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1163291725 19:16383630-16383652 GTGTTTACACAGATGAGCCTGGG - Intronic
1164295543 19:23906553-23906575 CCCTGCACACAGATGGGATTGGG + Intergenic
1164412355 19:28016528-28016550 ATGCTTGCACAGATGAGATTTGG - Intergenic
1166377260 19:42334450-42334472 TGGTGTTCACAGATGAGAGTGGG - Intronic
1166434700 19:42757715-42757737 CAGTGAACACAGCTGGGATTTGG - Intronic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1166493839 19:43283805-43283827 CAGTGAACACAGAAGAAATTTGG - Intergenic
1166897244 19:46031786-46031808 GTGTGCACATAGGTGAGATTTGG + Intergenic
925075279 2:1011293-1011315 CTGGTTACACAGATAAGCTTTGG + Intronic
926078146 2:9959492-9959514 TTGTGTTCACAGATAGGATTTGG + Intronic
930190270 2:48451789-48451811 CTCTTTAGACAGATGGGATTAGG + Intronic
930600940 2:53442377-53442399 CTGTGGACAGAGCTGAGAATTGG + Intergenic
931292232 2:60882942-60882964 CTATATACACAGATGTGGTTGGG + Intronic
933255945 2:80080643-80080665 CTGTGTACACATATTTTATTTGG + Intronic
934495301 2:94790783-94790805 CTGTTTAAACAGCTGACATTTGG + Intergenic
935432092 2:102987284-102987306 CTGTGTAAAGAGATCTGATTAGG - Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
940552831 2:155183289-155183311 TTGTGTACACAGAGTATATTAGG - Intergenic
941245330 2:163088724-163088746 CTGTCCACACAGATGAGTTTAGG + Intergenic
944518316 2:200535592-200535614 CTGTGAACAGAGTTGAAATTTGG - Intronic
945422093 2:209650891-209650913 CTGTGTACACAAAATAAATTGGG + Intronic
946674407 2:222143261-222143283 CAGAGTACACAGATCATATTAGG - Intergenic
946960272 2:224977832-224977854 CTTTGTGCAGAGATAAGATTTGG - Intronic
948300216 2:236900478-236900500 TTGTGTACACCACTGAGATTTGG + Intergenic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1174581621 20:51576256-51576278 CTGTGCACACACATGAGCTGAGG - Intergenic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1179612653 21:42562681-42562703 CTGTGTTCACACATGACATGGGG - Intronic
1181257902 22:21576031-21576053 CTGTGTCCAAAGATGAGCATAGG + Intronic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1182368527 22:29794584-29794606 CTGTGTACAGAGGTCTGATTAGG + Intronic
949258022 3:2073187-2073209 CTGTGTAAACACATGAAATATGG + Intergenic
954457240 3:50606449-50606471 CTGTGTACACAACTGAAAATCGG + Intergenic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
958006138 3:87813572-87813594 CTGTGAAAAGACATGAGATTTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960794571 3:121471802-121471824 CTGGGTACAGAGATGAGTATTGG - Intronic
961209090 3:125111447-125111469 CTGTGGGTACAGATGAGATCTGG - Intronic
964568858 3:158090341-158090363 CTTTTTAGACAGGTGAGATTAGG - Intergenic
966239173 3:177736898-177736920 CGGTGCACACAGATGTGATGTGG - Intergenic
966685222 3:182685940-182685962 CTGTATTCACAGAAAAGATTTGG + Intergenic
967664782 3:192158136-192158158 CTGTGTACAACCATGAGGTTTGG - Intronic
968266668 3:197368234-197368256 CTGTGTACAATGCTGAGCTTTGG + Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
970018136 4:11535590-11535612 CTGGGGAGACTGATGAGATTAGG + Intergenic
971498776 4:27296347-27296369 CTTTTAACACAGAAGAGATTGGG - Intergenic
973571445 4:52243649-52243671 GTGTGTTCATAGAAGAGATTTGG - Intergenic
973643306 4:52924867-52924889 CTGCATTCACAGATGAGATGTGG - Intronic
973928528 4:55765226-55765248 CTGTGTAAACAGGAGCGATTTGG + Intergenic
976759182 4:88529944-88529966 CTGTGTTCTCAGATTATATTAGG + Intronic
982979194 4:162109382-162109404 CTTTGAGCAGAGATGAGATTTGG - Intronic
986013883 5:3740757-3740779 CTGAGGACACAGAAGAGGTTGGG - Intergenic
986345111 5:6827443-6827465 CTGTGTGCACAGATTTGATTAGG - Intergenic
988625984 5:32875053-32875075 CAGTGTAAACTGATGTGATTTGG - Intergenic
989685993 5:44088066-44088088 ATATGTACACAGATGAGGTCTGG - Intergenic
991028275 5:62053871-62053893 CTGTTTACATAGCTAAGATTTGG - Intergenic
993933094 5:93967179-93967201 ATTTGAACACAGATGACATTTGG - Intronic
994892977 5:105662229-105662251 TTGTGTACCCAGCAGAGATTTGG - Intergenic
998896370 5:146804405-146804427 CTTTGTACACAGATGGCCTTGGG - Intronic
999712837 5:154333514-154333536 CTATGTACACTGAGGAAATTGGG - Intronic
999821167 5:155230315-155230337 CTGTGTACACAGATGATTGTAGG + Intergenic
999893308 5:156002204-156002226 CTGTATAAGAAGATGAGATTAGG + Intronic
1002836989 6:873334-873356 CTGTGTAAGAAGAGGAGATTAGG + Intergenic
1007204727 6:40139595-40139617 CTGTGTAGGCATATGAGATAAGG - Intergenic
1007229215 6:40336776-40336798 TTGTGAACACAGATGTGACTTGG + Intergenic
1010566352 6:77418772-77418794 TTGTGTACATATATGAGATAAGG - Intergenic
1013613334 6:111817162-111817184 CTGTGTATACAGGTGGGATTTGG + Intronic
1013626383 6:111941153-111941175 CTGTTTACAAAGATGTGAGTGGG - Intergenic
1014262868 6:119239853-119239875 CTGTGTACAGAACTTAGATTGGG - Intronic
1015927374 6:138323694-138323716 CTGTGTTCACTGAGGAGATGTGG + Exonic
1016571228 6:145515350-145515372 TTGTGAACACAGATCAGATTGGG + Intronic
1016629623 6:146213281-146213303 GAGTGTCCAGAGATGAGATTGGG + Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1018866356 6:167749473-167749495 CTGTGTACACAGATGCTCTCTGG - Intergenic
1019496509 7:1342883-1342905 GTGGACACACAGATGAGATTTGG - Intergenic
1019496512 7:1342906-1342928 ATGGGGACACAGATGAGATTTGG - Intergenic
1023238374 7:38115093-38115115 CTGGGTATACAGAAGGGATTAGG - Intergenic
1024225597 7:47324357-47324379 TTAAGTACACAGATGAAATTGGG + Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028154300 7:87411783-87411805 CTGTGTCCAAAGATGAGGTCAGG - Intronic
1029951074 7:104586384-104586406 TTGTGCACACAGATGATATCAGG - Intronic
1030849752 7:114468820-114468842 CTGTGTTAACTGATGAGAATTGG - Intronic
1031985952 7:128164871-128164893 CTGTGGGCCCAGATGAGACTGGG + Intergenic
1033204195 7:139403029-139403051 CTGTGTACGCTTTTGAGATTTGG + Intronic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1039949304 8:42155470-42155492 CTGCTTGCAAAGATGAGATTGGG + Intronic
1040456343 8:47601813-47601835 CTGTGTACAAAGATGAACTTTGG + Intronic
1041971000 8:63742627-63742649 CTGTGTACTCAGAAGAGAGGAGG + Intergenic
1042735393 8:71982141-71982163 TTGTGTACACAAATGAGATAAGG - Intronic
1043182041 8:77097156-77097178 CTTTCTACACTGATGATATTTGG - Intergenic
1044141888 8:88665835-88665857 GTAAGTACACAGATTAGATTAGG - Intergenic
1045338253 8:101228237-101228259 CTTTGTCCACGGATGAAATTTGG - Intergenic
1045648887 8:104324886-104324908 CTCTGTACACAGAACAGACTTGG + Intergenic
1052457530 9:28719459-28719481 TTTTGTACACTGATGAGTTTGGG - Intergenic
1052987338 9:34497392-34497414 ATGTGTATACTGATGAGATCTGG + Intronic
1053256703 9:36623371-36623393 CGGTGTACAAATAAGAGATTTGG + Intronic
1055416238 9:76086474-76086496 CTCTGTGAACAGATGAGATGAGG + Intronic
1055773756 9:79745570-79745592 CTGTCTCCACGGATGAGTTTGGG - Intergenic
1057275997 9:93676244-93676266 TTGTGTGCCCAGATGAGGTTGGG - Intronic
1057957960 9:99426480-99426502 CCTGGTGCACAGATGAGATTTGG - Intergenic
1058644836 9:107121299-107121321 ATATGTACACATATCAGATTAGG + Intergenic
1059538064 9:115102169-115102191 CTTTGGACTCAGATGGGATTTGG - Intronic
1061739055 9:132686113-132686135 TTGTTTTTACAGATGAGATTGGG + Intronic
1187230585 X:17418480-17418502 CTGTTTTGACAGATTAGATTTGG - Intronic
1187572308 X:20517502-20517524 CATGGTACACAGATGACATTTGG + Intergenic
1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG + Intronic
1196199122 X:112865627-112865649 CTGTGTACCCAGACAAGATGTGG + Intergenic
1199997352 X:153033823-153033845 CTGTGAAAAGAGATGACATTGGG - Intergenic