ID: 1080734188

View in Genome Browser
Species Human (GRCh38)
Location 11:34994919-34994941
Sequence GATGCCAAACATCCCCAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080734188_1080734191 23 Left 1080734188 11:34994919-34994941 CCAACTTGGGGATGTTTGGCATC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1080734191 11:34994965-34994987 CCCTCCTCAGGCCTGCATTTTGG 0: 1
1: 0
2: 1
3: 19
4: 221
1080734188_1080734195 30 Left 1080734188 11:34994919-34994941 CCAACTTGGGGATGTTTGGCATC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1080734195 11:34994972-34994994 CAGGCCTGCATTTTGGCGGTTGG 0: 1
1: 0
2: 1
3: 12
4: 103
1080734188_1080734193 26 Left 1080734188 11:34994919-34994941 CCAACTTGGGGATGTTTGGCATC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1080734193 11:34994968-34994990 TCCTCAGGCCTGCATTTTGGCGG 0: 1
1: 0
2: 1
3: 25
4: 182
1080734188_1080734189 11 Left 1080734188 11:34994919-34994941 CCAACTTGGGGATGTTTGGCATC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1080734189 11:34994953-34994975 TGCAGTGATTAACCCTCCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080734188 Original CRISPR GATGCCAAACATCCCCAAGT TGG (reversed) Exonic
906419462 1:45652187-45652209 AATGCCAAATATCCCCCAGCGGG + Intronic
909220050 1:72946439-72946461 GATGCCAAACATCCCCTGAGGGG + Intergenic
909445431 1:75743583-75743605 GATGCCATGCATCCCCAGGATGG + Intronic
911717294 1:101147639-101147661 AATACCAAACATCACAAAGTTGG + Intergenic
920016817 1:202917796-202917818 GGTGCTACAGATCCCCAAGTGGG - Intronic
922279467 1:224109633-224109655 AATGCTAAACAACCCAAAGTAGG + Intergenic
922376887 1:224977915-224977937 GATGCCCAACATCCCCAATCAGG + Intronic
924090943 1:240500206-240500228 GATGACCAGCATCCCAAAGTTGG + Intronic
924543493 1:245003568-245003590 GATGTCAATCTTCCCCAAATAGG - Intronic
1064607752 10:17061523-17061545 GATGACAAACATGCCCAAAGAGG - Intronic
1067298141 10:44986994-44987016 GATACCAACCAACTCCAAGTAGG - Intronic
1069873707 10:71548602-71548624 GATGCCAAACCTTGCCAAGGGGG + Intronic
1071473059 10:86000357-86000379 GATGCCAATCCTCTCCAAATTGG + Intronic
1072052265 10:91717563-91717585 GATGCCAATTATCCCCAAATTGG + Intergenic
1072881480 10:99233339-99233361 GGTTCCAAACGGCCCCAAGTGGG - Intronic
1073939171 10:108674451-108674473 GCTGCAACACATCCCCATGTAGG + Intergenic
1074529230 10:114285849-114285871 GATGCCGAACATCTCCCAGGAGG - Intronic
1075581916 10:123625320-123625342 GATGCCTAACATCACAAAATGGG - Intergenic
1077052699 11:574916-574938 GATTCCAAACCTCTTCAAGTTGG + Intergenic
1078410429 11:11111319-11111341 GATGTCAACCCTCCCCAAATTGG + Intergenic
1080072082 11:28101171-28101193 AATGCCAAACATCCTCTAATAGG - Intronic
1080734188 11:34994919-34994941 GATGCCAAACATCCCCAAGTTGG - Exonic
1085503609 11:77042862-77042884 GTTGCCAAACATACCCTGGTGGG + Intergenic
1086760830 11:90628491-90628513 GATGGCCAACAGACCCAAGTTGG - Intergenic
1090817468 11:130311704-130311726 TATGCCAAACATCCAGAACTTGG + Intronic
1095775564 12:46005871-46005893 TAACCCAAACATCCCCAAGTAGG - Intergenic
1098038981 12:66335234-66335256 CATGCCAATGATTCCCAAGTGGG - Intronic
1098530510 12:71536569-71536591 GAAGCAAAACAGCCTCAAGTTGG + Intronic
1099424061 12:82501358-82501380 GCTGCCTAACATCCTCAAATGGG + Intergenic
1100629763 12:96375869-96375891 GGTGTCAGACATGCCCAAGTAGG - Intronic
1102031717 12:109743685-109743707 GATGCCCAAGATGACCAAGTGGG + Intronic
1108182514 13:47854927-47854949 GAGCCCAACCATCGCCAAGTGGG + Intergenic
1110462697 13:75763150-75763172 GTGGCCAAACATCCCCTGGTTGG - Intronic
1110690777 13:78428098-78428120 AATCCCAAACATCCCTAAGGTGG - Intergenic
1112665431 13:101566598-101566620 TCTGCCAAACATGCCCAAATGGG + Intronic
1113017871 13:105848673-105848695 GATGCCAAACAGCACAAATTGGG + Intergenic
1119451118 14:74711591-74711613 CCTGCCACACATCCTCAAGTTGG + Intronic
1119471269 14:74901181-74901203 GATGCCATGCATCCCCAGGATGG - Exonic
1128092534 15:64928742-64928764 GATGCTGGACATCCCCAAGGTGG + Intronic
1128885395 15:71282240-71282262 GATGCCAAACATTCCTCATTTGG - Intronic
1132423326 15:101692938-101692960 GAAGCAAAAATTCCCCAAGTGGG + Intronic
1132653483 16:1031847-1031869 GGTGGCAAACATGCCCAGGTTGG + Intergenic
1132950550 16:2559896-2559918 GATTCCAAACAGCCCCATGGAGG - Intronic
1132963799 16:2640274-2640296 GATTCCAAACAGCCCCATGGAGG + Intergenic
1132975182 16:2707505-2707527 AAGGCCAGACGTCCCCAAGTTGG + Exonic
1134352586 16:13451654-13451676 GAGGACAAAGATCCCCTAGTTGG + Intergenic
1137648090 16:50093445-50093467 GTTGCCAAATGTCCCCAGGTGGG - Intronic
1142581458 17:945671-945693 GATGTTAAACATCACAAAGTCGG + Intronic
1146475409 17:33158504-33158526 AATGCCAAAGATCTCCAGGTGGG + Intronic
1146562490 17:33883288-33883310 AATACAAAACAGCCCCAAGTGGG + Intronic
1147120580 17:38333058-38333080 GAGGCCACACACACCCAAGTGGG - Intronic
1151380773 17:73724332-73724354 GCTGCAAAAAATCCCAAAGTGGG - Intergenic
1152461321 17:80443911-80443933 GCTGCCAATCACCCCCAAGTAGG - Intergenic
1153553322 18:6284901-6284923 GAGGGAAAACATCCACAAGTTGG + Intronic
1156565905 18:38189895-38189917 GATGCCAAACAATCCCATGGGGG + Intergenic
1158030721 18:52961581-52961603 GATACCAAACACCACAAAGTTGG + Intronic
1159488530 18:69098815-69098837 GTTTCCATACATCCCAAAGTAGG + Intergenic
1159707117 18:71705458-71705480 AATGCCAAATATGCACAAGTGGG - Intergenic
1159920500 18:74223420-74223442 GATGGCGAACATCTCCAGGTAGG - Intergenic
925072088 2:977573-977595 GATGGCAAAGGTTCCCAAGTGGG - Intronic
927324361 2:21786097-21786119 GATTCCAAACATACACATGTGGG + Intergenic
1170654974 20:18278079-18278101 GAAGCCAAAGATCCCTAGGTTGG + Intergenic
1172193153 20:33074472-33074494 GGTGAAAAATATCCCCAAGTTGG + Intergenic
1172616135 20:36286049-36286071 GATGCCAAGTTTCCTCAAGTAGG - Intergenic
1173921013 20:46744700-46744722 GATGAGAAACATTCCCAGGTAGG + Intergenic
1174542294 20:51299066-51299088 GATGGCAAACATCACCATTTGGG + Intergenic
1178754201 21:35332421-35332443 AATGCCAAACATCCCCTGGCGGG - Intronic
1184991867 22:48175835-48175857 GCTGTCATTCATCCCCAAGTAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
955004930 3:54959480-54959502 GTTGCCAAACATCTCTGAGTTGG - Intronic
955507257 3:59644848-59644870 GCTGGCAAGCATCCCCAAGCGGG + Intergenic
956388524 3:68747002-68747024 AATGTCAAATATCCCCAAGGGGG + Intronic
960930727 3:122846601-122846623 GATGCCAAACTTCTCCAAAGTGG + Intronic
961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG + Intergenic
967535726 3:190600633-190600655 CATCCAAAACATCCACAAGTAGG + Intronic
970415352 4:15851231-15851253 GATGGCAAAGATACCCACGTTGG - Exonic
979611196 4:122690714-122690736 GATGCAAAAAATTCCCAAATAGG + Intergenic
981300280 4:143178968-143178990 GATACCAGACATCCCTAAGGTGG - Intergenic
983206983 4:164920670-164920692 GAAGCCAAATCTCGCCAAGTAGG - Intergenic
985141378 4:186843544-186843566 ATTGCCAAACATCCCCTAGGAGG - Intergenic
985682951 5:1265990-1266012 GATCCCAAACAACCCCACGCAGG + Intronic
988004470 5:25390405-25390427 GTTGCTACACATCCTCAAGTGGG + Intergenic
990927530 5:61044590-61044612 GATGCCAAAAATCCACAATGGGG - Intronic
998026718 5:138823237-138823259 GATGCCAAAAATACACAAGATGG - Intronic
998725772 5:145012375-145012397 GATGTCAAACATTAGCAAGTAGG + Intergenic
1000422827 5:161057686-161057708 GTTGCAACACATACCCAAGTGGG + Intergenic
1001105726 5:168852503-168852525 GATGGCAAACATCCCCACTCAGG + Intronic
1003139845 6:3461808-3461830 GATGAGAATCATCCCAAAGTTGG + Intergenic
1003996214 6:11542469-11542491 TATGCCGAACATCCCAAACTAGG + Intronic
1004355168 6:14924203-14924225 ATTGCCAAACATCCCCTGGTGGG - Intergenic
1009589791 6:65652940-65652962 GAAGCCAAATATCTCCCAGTAGG + Intronic
1012100552 6:95080309-95080331 GATACCAAACACCACAAAGTTGG + Intergenic
1014672585 6:124324187-124324209 GATGCCAATTATCCTCAAATTGG - Intronic
1023213396 7:37832585-37832607 TAGGACAAACATCCCCAACTGGG - Intronic
1029069453 7:97883370-97883392 GAAGAAAAACATACCCAAGTGGG - Intergenic
1032675328 7:134124900-134124922 GATGCCCAGAATCCCAAAGTAGG + Intergenic
1034041070 7:147877017-147877039 AATGACAAACAGCCCCACGTGGG - Intronic
1034275773 7:149823207-149823229 GATGCCCACCCTCCGCAAGTTGG - Intergenic
1038679208 8:29651391-29651413 GATTCCAGCCATCCCTAAGTGGG + Intergenic
1044602118 8:94015755-94015777 CATGCCCTACATCCCCAAGCTGG + Intergenic
1048117129 8:131536544-131536566 GAAGCTAAACATACCAAAGTAGG - Intergenic
1048341704 8:133544922-133544944 GATGGCAATCATGCCCAAGCTGG + Intronic
1049012645 8:139897642-139897664 GTTACCTAACATCCCCAAGGAGG - Intronic
1053064205 9:35056139-35056161 AATCCCAAACATCCCCTGGTTGG - Exonic
1057394650 9:94669077-94669099 ATTGCCAAACATCCCCAGGGAGG + Intergenic
1058623924 9:106914427-106914449 ACTGCCAAACAGCCCCAAGTTGG + Intronic
1059119455 9:111628794-111628816 GATGCCAACCATCTCCACATTGG - Intergenic
1059795939 9:117696927-117696949 CATGCCCAACGTCTCCAAGTAGG - Intergenic
1185763096 X:2703245-2703267 GCTTTCAAATATCCCCAAGTCGG + Intronic
1187187668 X:17002680-17002702 GGTGTCAACCCTCCCCAAGTGGG - Intronic
1192609570 X:72554369-72554391 GATGCCAAACAACTGTAAGTTGG + Intronic
1194291691 X:92080618-92080640 GAAGCCAAAAATCCCTAAGAAGG - Intronic
1200609207 Y:5305197-5305219 GAAGCCAAAAATCCCTAAGAAGG - Intronic