ID: 1080735313

View in Genome Browser
Species Human (GRCh38)
Location 11:35008398-35008420
Sequence TCTGGTCTGCAGAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080735313_1080735318 18 Left 1080735313 11:35008398-35008420 CCTTTCACCTTCTGCAGACCAGA 0: 1
1: 0
2: 1
3: 14
4: 236
Right 1080735318 11:35008439-35008461 GATCTTGGAGAGCTTGGAGAAGG 0: 1
1: 0
2: 2
3: 35
4: 248
1080735313_1080735316 3 Left 1080735313 11:35008398-35008420 CCTTTCACCTTCTGCAGACCAGA 0: 1
1: 0
2: 1
3: 14
4: 236
Right 1080735316 11:35008424-35008446 TGCAACAAGCACAGCGATCTTGG 0: 1
1: 0
2: 0
3: 14
4: 113
1080735313_1080735319 24 Left 1080735313 11:35008398-35008420 CCTTTCACCTTCTGCAGACCAGA 0: 1
1: 0
2: 1
3: 14
4: 236
Right 1080735319 11:35008445-35008467 GGAGAGCTTGGAGAAGGTCATGG 0: 1
1: 0
2: 2
3: 34
4: 385
1080735313_1080735317 12 Left 1080735313 11:35008398-35008420 CCTTTCACCTTCTGCAGACCAGA 0: 1
1: 0
2: 1
3: 14
4: 236
Right 1080735317 11:35008433-35008455 CACAGCGATCTTGGAGAGCTTGG 0: 1
1: 0
2: 1
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080735313 Original CRISPR TCTGGTCTGCAGAAGGTGAA AGG (reversed) Intronic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904376086 1:30083375-30083397 TCTGTCCTGCAGATGGAGAAAGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
906202951 1:43971638-43971660 TCTGGACAGCAGGAGGAGAAGGG - Exonic
907682433 1:56577609-56577631 TCTGGTCTGCAAAATCTGCATGG + Intronic
909435164 1:75632534-75632556 AATGGTCAGCAGAGGGTGAAGGG - Intergenic
909481816 1:76134376-76134398 TCAGGCCTGGAAAAGGTGAAGGG - Intronic
911122622 1:94311205-94311227 TCTGGTATTCAGTAAGTGAAAGG + Intergenic
912434344 1:109649500-109649522 TCTGCTCTGCAGATGGAAAATGG + Intergenic
915010212 1:152678512-152678534 TCAGGTCTGAAGAAAGAGAAAGG + Intergenic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
920210705 1:204326212-204326234 TCTGGTCTTCACAAACTGAAGGG - Intronic
921046327 1:211480284-211480306 ACGGGGCTGAAGAAGGTGAAAGG + Intronic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921470672 1:215544623-215544645 TATGGTCTGGAAACGGTGAATGG - Intergenic
923883424 1:238129190-238129212 TGTGGTTTGCAGCAGGAGAAAGG + Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
924134288 1:240947525-240947547 TCTGGACTGGAGTCGGTGAATGG - Intronic
924664573 1:246057851-246057873 GATGGCCTTCAGAAGGTGAATGG + Intronic
1062941988 10:1429046-1429068 TCTGGTCTGAATAAGGTGGGTGG + Intronic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1064130106 10:12701933-12701955 TCTAGTCAGCAGAAGGGAAAAGG + Intronic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1069363016 10:67665533-67665555 TCTGTCCTGCAGTAGGTGAGTGG - Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070805586 10:79268900-79268922 GCAGGGCTGCAGAAGGTGATTGG + Intronic
1071571201 10:86698411-86698433 TCTGGTCTGGAGGATGTGATCGG + Intronic
1072443046 10:95474081-95474103 TCTGGGCTGAGGAAAGTGAATGG - Intronic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1075521710 10:123147550-123147572 TGAGGTCTGCAGACGGGGAAGGG + Intergenic
1075982033 10:126748361-126748383 TCTGGTCTGCAGGTGGGGAATGG - Intergenic
1076285464 10:129291564-129291586 TCTGGTCTGTAGATTCTGAATGG - Intergenic
1076361141 10:129889645-129889667 TCTGGTCATTAGAAAGTGAACGG - Intronic
1077353568 11:2104243-2104265 TCTGGGCATCAGCAGGTGAAAGG - Intergenic
1077513085 11:2981858-2981880 TGTATTCTGCAGAAGGTGACGGG - Intronic
1077513403 11:2984617-2984639 TGTATTCTGCAGAAGGTGACGGG - Intronic
1077596626 11:3537578-3537600 CCTAGACTTCAGAAGGTGAATGG - Intergenic
1078272094 11:9805421-9805443 TCTGTCCTACAGTAGGTGAATGG - Intronic
1079647048 11:22878099-22878121 TTTGGTCTGCTGCAGGAGAAAGG + Intergenic
1080420371 11:32104786-32104808 CCTGTTCTTCAGAAGGTGAGTGG + Exonic
1080478001 11:32615753-32615775 TCTGGTCATCAGAAGGTTACTGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1084156846 11:67317935-67317957 CCCGGTCTGCAGAAGGTCCAGGG + Intronic
1087993357 11:104773551-104773573 TATGGTCTTCAGAAGATAAAAGG - Intergenic
1088553076 11:111034374-111034396 TCTGTGCTGCAGAAAATGAATGG + Intergenic
1089290590 11:117435762-117435784 TCAAGTCTGCTCAAGGTGAAGGG - Exonic
1089772755 11:120815264-120815286 GCGGGTGTGCAGAAGGTGAGGGG + Intronic
1090334238 11:125951969-125951991 TTGGGCCTGCAGGAGGTGAACGG - Intergenic
1090412464 11:126518725-126518747 CCTGGTCTGGGGAAGGGGAATGG - Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090673688 11:128969871-128969893 CGTGCTCGGCAGAAGGTGAAAGG - Exonic
1090880935 11:130830903-130830925 TCTGGCCTGCAGAGCCTGAAGGG - Intergenic
1091328078 11:134707114-134707136 TCTGGGCTGCAGTAGGTGTAGGG + Intergenic
1091648577 12:2292457-2292479 TCTGTACTGCACAATGTGAAAGG - Intronic
1093127106 12:15343803-15343825 TCTGGTCTGAGGCAGGAGAATGG - Intronic
1093615440 12:21216775-21216797 TGTGCTCTGCAGAGGGTAAAAGG + Intronic
1093768122 12:22988321-22988343 TGTGGGCTGGAGAAGCTGAAGGG - Intergenic
1094483651 12:30905992-30906014 TTTGGCCTAAAGAAGGTGAAAGG + Intergenic
1094525226 12:31226886-31226908 TCTGGTGGGCAGGAGGTGACTGG + Intergenic
1096752194 12:53767773-53767795 TCTGGTAGGGAGAAGGTGTAGGG + Intergenic
1098052572 12:66470120-66470142 TCTGGATTGGGGAAGGTGAAGGG - Intronic
1099679579 12:85807708-85807730 TCTGTTCTATAGAAGGTCAAGGG + Intronic
1100435743 12:94569986-94570008 TCTGGGCTGAAGGCGGTGAATGG + Exonic
1101577795 12:106014021-106014043 TCTGGCCTGGAGAAGTTTAAAGG - Intergenic
1101595537 12:106161304-106161326 CATGGTCTGCAAAAGGAGAAAGG + Intergenic
1101789993 12:107917824-107917846 TCTCCTCTGCAGAAGATGACGGG + Intergenic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1108593907 13:51934477-51934499 GCTGGACTGTAGAAGGTGAGAGG - Exonic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1113124812 13:106965667-106965689 CCTGGTCTCCAGCTGGTGAATGG - Intergenic
1113365600 13:109672779-109672801 TATGGTCAGCAGAATGTGGAAGG - Intergenic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1117100766 14:52344283-52344305 TCTGTTCTGGAAAAGGTAAAGGG - Intergenic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117677298 14:58167554-58167576 TCTGGACTGCAGGTGGAGAATGG - Intronic
1118249242 14:64142986-64143008 TCTGGTAGGCAGAAGATGAATGG + Intronic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1124215553 15:27805197-27805219 GCTGGCCTGGAGCAGGTGAAAGG + Intronic
1124269116 15:28265001-28265023 TCTCTCCTGCAGAAGTTGAATGG - Intronic
1127811523 15:62569309-62569331 TCTGGCCTGTAGGAGTTGAATGG - Intronic
1127883227 15:63176259-63176281 TCTGTTGGGGAGAAGGTGAAGGG - Intergenic
1128732351 15:70029751-70029773 ACTGCTTGGCAGAAGGTGAAAGG + Intergenic
1130652852 15:85772168-85772190 TCTGGTCTGCAGACCGTGCTGGG + Intronic
1132004270 15:98212629-98212651 TCTCTTCTGCAGAAGCTGCAAGG + Intergenic
1133007988 16:2895203-2895225 TCTGGCCTGGAGAAGCAGAAAGG - Exonic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137865892 16:51895591-51895613 TCTGCTCTGCTGAGAGTGAATGG + Intergenic
1138336787 16:56259678-56259700 AGTGGTCTGCAGAAGGGGCAGGG + Intronic
1141409376 16:83822079-83822101 TCTGGCCTCCAGACCGTGAAAGG - Intergenic
1141832112 16:86515692-86515714 TCTGGCCTGCAGAGGCTGACCGG - Intergenic
1142328319 16:89433110-89433132 TCTGTTCTAAAGAAGCTGAATGG - Intronic
1143039735 17:4025000-4025022 GCTGCTTTGCAGAAGGTGACTGG + Exonic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1147154432 17:38536557-38536579 TCTGGGCGTCAGAATGTGAAGGG - Intronic
1149423287 17:56531163-56531185 TGGGGCCTGCAGAAGGTGAGTGG - Intergenic
1149454462 17:56776783-56776805 GCTGGAATGGAGAAGGTGAATGG - Intergenic
1150723977 17:67636666-67636688 TCTGGCCTGTTGAAGGTGATGGG - Intronic
1151143367 17:72016493-72016515 TGGGGTCTGGAGAAGGAGAAAGG + Intergenic
1151312889 17:73305019-73305041 GCAGGTCAGCAGGAGGTGAAGGG + Intronic
1151560115 17:74865516-74865538 GCTGGAGTGCAGAAAGTGAAGGG + Intronic
1152108524 17:78344085-78344107 TCTGGTCTTCAGTAGCTGAAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1155366796 18:25056992-25057014 TCTGGCCTGCTGAAGTTAAATGG + Intergenic
1157325282 18:46664513-46664535 TCTGGCCTGAGGAAGCTGAAGGG - Intergenic
1157574773 18:48736251-48736273 TCTGGGATGAGGAAGGTGAAGGG + Intronic
1158152902 18:54392750-54392772 TCAGGTTTCCAGAAGGAGAAAGG - Intergenic
1158181055 18:54715254-54715276 GCTGGACTGCAGAAGGGGAGTGG - Intergenic
1158639443 18:59190942-59190964 TTTGGCCTGTAGAAGCTGAATGG - Intergenic
1159937722 18:74382335-74382357 TCTGCTCTGCGGGAGGAGAAGGG - Intergenic
1160063548 18:75553298-75553320 GCAGGTCTTCAGAAGGAGAAAGG + Intergenic
1163401939 19:17099356-17099378 TGGGGACTGCAGAAGGTGATGGG + Intronic
1164493691 19:28737730-28737752 TCTGGACTGCAGAACTGGAAGGG + Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925439494 2:3872145-3872167 GCTGCACAGCAGAAGGTGAACGG - Intergenic
927243082 2:20935681-20935703 TCTGGGTTGCAAAAGGTGAAGGG - Intergenic
927341580 2:21989616-21989638 TCTGCACAGCAGGAGGTGAATGG + Intergenic
928524817 2:32129440-32129462 TAGGGTCAGCAGAGGGTGAATGG - Intronic
929079254 2:38106266-38106288 TCCGGCCTGGGGAAGGTGAAAGG - Intronic
929514718 2:42596577-42596599 TCTGGTCTTCTGAATGTTAATGG + Intronic
930538301 2:52671555-52671577 TTTGGCCTGCAGAAAGTAAACGG + Intergenic
930986806 2:57598924-57598946 ACAGGTATGGAGAAGGTGAAAGG + Intergenic
931879093 2:66547945-66547967 TCTGTTCTTCAGAAGGGTAAGGG - Exonic
931987429 2:67755408-67755430 TCTGGTGGGCAGAATGTGATGGG - Intergenic
935301119 2:101694877-101694899 TCTGGTATGCAGAGGAGGAAAGG + Intergenic
937953461 2:127405950-127405972 TCTGGCCTGCAGATGGTGTGGGG - Intergenic
940382088 2:153026623-153026645 GATGGCCTTCAGAAGGTGAATGG - Intergenic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
942777954 2:179607444-179607466 TCATGGCAGCAGAAGGTGAAGGG - Intronic
946086985 2:217183642-217183664 TCTGGTCTGGAGATGGTCCAGGG + Intergenic
947457023 2:230264859-230264881 CCTGTTCTGCTGGAGGTGAAGGG + Intronic
948497098 2:238357902-238357924 TTTGGGCTTCAGAAGATGAAAGG + Intronic
1170321267 20:15100724-15100746 TCTGATCTGCAGAAGGTTCCAGG - Intronic
1170433502 20:16298774-16298796 TCTGGTTTTCAGAAGATGCAGGG + Intronic
1171202023 20:23249784-23249806 TCTGCTCAGCAGAAGGTGGTGGG + Intergenic
1171295831 20:24016037-24016059 TGTTGTCTGGAGAAGGTGATAGG - Intergenic
1174795297 20:53517271-53517293 ACTGGACAGCAGGAGGTGAATGG + Intergenic
1178272805 21:31208414-31208436 TCAGCTCTGCAGAATGTTAATGG + Intronic
1180222851 21:46370287-46370309 TCTGGTCTGCAGGCAGTGAGTGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182745439 22:32602220-32602242 CCTGGTCTGGAGAAGGGGAGTGG - Intronic
949869102 3:8571646-8571668 CCTGGTCTGCAGCTGGAGAAAGG + Intergenic
951503907 3:23419883-23419905 TCAGGTCTGCAGAAGTCCAAGGG + Intronic
954964273 3:54596726-54596748 TCTGGTTTTAAGAAGGTGCATGG - Intronic
955011120 3:55015336-55015358 TCTGTTTTGCAGATGGTGAATGG - Intronic
956533088 3:70243145-70243167 TCTTGTCTGCAGAAGACAAAAGG - Intergenic
958157310 3:89771401-89771423 TCTGGATTTCAGAAGGTGTATGG - Intergenic
959425861 3:106187651-106187673 TCTGGTCAGGGGAAGGAGAAGGG - Intergenic
960044182 3:113180219-113180241 TTGGGTCTTCAGAAAGTGAAAGG + Intergenic
961049392 3:123733885-123733907 TCTCTTCTCCAGAAGGTGATAGG + Exonic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962254503 3:133861107-133861129 CCAGGCCTGCAGAAGGGGAAGGG + Intronic
964411485 3:156402540-156402562 TCTGTTCTGCAAAGGGAGAAAGG - Intronic
965470614 3:169085734-169085756 TCTGCTGAGCAGAAGGTGCATGG + Intronic
967063311 3:185891690-185891712 TCTGGTCTGCAGAATCTGAACGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967816251 3:193800866-193800888 TGTGATCTGCAGATTGTGAAGGG + Intergenic
971007547 4:22391965-22391987 TATAGTCTGCAGGAGGAGAAAGG - Intronic
973856297 4:55013684-55013706 TCTGGCCTGAAGAAGCTGGATGG + Intergenic
976572167 4:86625083-86625105 TCTGGTCTGCTGAAGTCAAAGGG - Intronic
978084093 4:104628932-104628954 TGTGGGCAGCAGAAGGAGAAAGG + Intergenic
980435857 4:132772665-132772687 TCTGTAATGAAGAAGGTGAAGGG - Intergenic
980748589 4:137057293-137057315 TTTGGCCTGTAGAAGGTAAATGG - Intergenic
980840693 4:138256909-138256931 TATGGTCTGCAAGTGGTGAAAGG - Intergenic
981077719 4:140607552-140607574 TGTGGTCTGGACAAGGTGACTGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981739325 4:147985594-147985616 TTTGCTCTGCAGCAGGGGAAAGG - Intronic
982062600 4:151619883-151619905 ACTGGTGTGCAGAATATGAAAGG - Intronic
982116480 4:152102713-152102735 TCTGTTATGGAGAAGGTGAGGGG - Intergenic
983074817 4:163313294-163313316 GATGTTCTTCAGAAGGTGAATGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
984931493 4:184851529-184851551 GCAGGTTTGCAGAAAGTGAAAGG + Intergenic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
985481267 5:112303-112325 TCTGGCCTGCAGTGGGAGAAGGG - Intergenic
985712561 5:1437722-1437744 GCAGGTCTGCAGGAGGGGAAGGG + Intronic
986084192 5:4426719-4426741 TCTGCCCTGCAGAGGGTGATTGG + Intergenic
986253170 5:6079774-6079796 TCGGGACTGCAGAAGAGGAATGG + Intergenic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
989718956 5:44502283-44502305 TCTGATCTGCAATAGGGGAAGGG - Intergenic
990301973 5:54458498-54458520 CTTGGTCTGCAGCAGGTTAAGGG - Intergenic
991414221 5:66375813-66375835 TCTTGTTTGCAGAAGATAAAAGG + Intergenic
993300830 5:86207511-86207533 TCAGGTCAGGAGAAGGTCAAAGG + Intergenic
993712088 5:91235356-91235378 TCTGGTCTCCAGATGGTCACAGG - Intergenic
993780168 5:92056532-92056554 AATGTTCTTCAGAAGGTGAAAGG - Intergenic
998392280 5:141795110-141795132 TGAGGTCTGCGGAAGGTGGATGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1000459381 5:161495598-161495620 TCTATACTCCAGAAGGTGAATGG + Intronic
1002284798 5:178154880-178154902 ACGGGTCTGTAGAAGGTAAAGGG + Intergenic
1002872129 6:1176684-1176706 TGTGGGCTGCAGCAGCTGAAGGG - Intergenic
1003982807 6:11405340-11405362 TCTGGTCTGGAGATGGCAAAAGG - Intergenic
1007499072 6:42281601-42281623 GCTGGTCTGGAGAAGGGGATTGG - Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1008649322 6:53547305-53547327 TATGGTGTGCAGCAGGTGTATGG - Intronic
1010397050 6:75404645-75404667 TATGGTCTGCTGAAAGTGAGTGG - Intronic
1011114998 6:83879895-83879917 TGTGCTCTGCTGAAGCTGAAGGG + Intronic
1011727424 6:90224714-90224736 TCTGGTCTGCAGAAGTTCCCTGG - Intronic
1014743939 6:125177607-125177629 AATGTGCTGCAGAAGGTGAAGGG - Intronic
1017657597 6:156645136-156645158 TCTGCTCTGCAGAAGAACAAGGG + Intergenic
1018934764 6:168266460-168266482 TCTGGTGAGGAGGAGGTGAAAGG - Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019213097 6:170422090-170422112 TCTGGACTGAGGAAGGTGACCGG - Intergenic
1020121623 7:5507310-5507332 TCCTGTCTGGAGAGGGTGAAAGG - Intronic
1022374067 7:29797065-29797087 TCTGGGAGGCAGAAGGTCAATGG + Intergenic
1022514680 7:30967985-30968007 GCTGGTCTGAAGATGGAGAAAGG - Intronic
1026989177 7:74573605-74573627 TCTGTTCTGCACAAGGTGCCTGG - Intronic
1029353245 7:100030482-100030504 TCTGGTCTACAAAAGGGGATAGG - Intronic
1031639780 7:124147779-124147801 TCTAGTATCCAGAAGATGAAAGG + Intergenic
1032079228 7:128850367-128850389 TGTGGCCTGCAGCAGGTGAGAGG - Exonic
1032083732 7:128872940-128872962 GCAGGACTGCAGAAGGTGACAGG + Intronic
1034528555 7:151681386-151681408 TCTGGACTACAGAGGGGGAAGGG + Intronic
1038711264 8:29948667-29948689 TCAGCTCTGCAGAAGCTAAATGG - Intergenic
1038837447 8:31142365-31142387 TCTGGTGTGTAGAAGTGGAAAGG + Intronic
1043743572 8:83844592-83844614 TCTGAACTTCAGAATGTGAAGGG - Intergenic
1043805686 8:84669706-84669728 TCTGGACTGTAAAAAGTGAATGG - Intronic
1045210071 8:100088306-100088328 TATAGTTTGCAGAAGCTGAAGGG - Intronic
1046266928 8:111842862-111842884 TCAGGAAGGCAGAAGGTGAATGG - Intergenic
1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG + Intergenic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049819213 8:144624443-144624465 ACTGGTCTTCAGAAGGAGATTGG - Intergenic
1050245706 9:3687821-3687843 TCTGTCATTCAGAAGGTGAAAGG - Intergenic
1051967745 9:22848954-22848976 TCTGGTCTTCTGCAGGTGATAGG - Intergenic
1053282246 9:36828046-36828068 TCTGGTCACTAGAATGTGAATGG + Intergenic
1054804746 9:69387036-69387058 GCAGGTCTGCAGAATGAGAAGGG - Intronic
1055947208 9:81702448-81702470 TTTGGTCTGCTGAATGTCAATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059071567 9:111142769-111142791 TCTGGGCTACAAAAGGTAAATGG - Intergenic
1059326629 9:113507648-113507670 GCTGGTGTGGGGAAGGTGAAGGG + Intronic
1061903179 9:133683419-133683441 TCTGGTTTGCAGAAGGGGAGGGG - Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1186893815 X:13986560-13986582 TCTGGGCAGCAGGAGGAGAAAGG + Intergenic
1187456346 X:19444637-19444659 TCTGCTCTGCAGAAGATGCCAGG - Intronic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190248181 X:48704551-48704573 ACTGTTCTCCAGGAGGTGAAGGG + Intronic
1195035328 X:100966714-100966736 TTTTGACTGAAGAAGGTGAATGG - Intergenic
1197241136 X:124124440-124124462 GATGTTCTTCAGAAGGTGAATGG + Intronic
1199117724 X:144012469-144012491 TCCGGTCTTCAGAAGGTGACTGG + Intergenic