ID: 1080741013

View in Genome Browser
Species Human (GRCh38)
Location 11:35064333-35064355
Sequence AAATGAGCAGGGCCCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080741007_1080741013 -4 Left 1080741007 11:35064314-35064336 CCCCTTATAATGAATCATCAAAT No data
Right 1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG No data
1080741006_1080741013 1 Left 1080741006 11:35064309-35064331 CCATTCCCCTTATAATGAATCAT No data
Right 1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG No data
1080741008_1080741013 -5 Left 1080741008 11:35064315-35064337 CCCTTATAATGAATCATCAAATG No data
Right 1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG No data
1080741009_1080741013 -6 Left 1080741009 11:35064316-35064338 CCTTATAATGAATCATCAAATGA No data
Right 1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080741013 Original CRISPR AAATGAGCAGGGCCCCTGCT GGG Intergenic
No off target data available for this crispr