ID: 1080749653

View in Genome Browser
Species Human (GRCh38)
Location 11:35140076-35140098
Sequence CCACACTGATTGGCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080749653_1080749660 17 Left 1080749653 11:35140076-35140098 CCTGCTTCTGCCAATCAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1080749660 11:35140116-35140138 GGTGGCTTATATTCCCTGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1080749653_1080749659 -1 Left 1080749653 11:35140076-35140098 CCTGCTTCTGCCAATCAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1080749659 11:35140098-35140120 GGGAAATCTCAACAGTAAGGTGG 0: 1
1: 0
2: 0
3: 18
4: 145
1080749653_1080749658 -4 Left 1080749653 11:35140076-35140098 CCTGCTTCTGCCAATCAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1080749658 11:35140095-35140117 GTGGGGAAATCTCAACAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080749653 Original CRISPR CCACACTGATTGGCAGAAGC AGG (reversed) Intronic
900466072 1:2826078-2826100 CCCCACTGGTGGGCAGAAGCCGG + Intergenic
902153033 1:14460372-14460394 ACACACAGCTTGGCAGCAGCCGG + Intergenic
902291482 1:15438400-15438422 GCACACTTATAGGCAGGAGCAGG - Intergenic
902614081 1:17614367-17614389 CCACAGTGTGTGGCCGAAGCGGG - Intronic
905572449 1:39016548-39016570 CCACACAGATTTGAATAAGCTGG - Intergenic
905826289 1:41028205-41028227 CCACATTGACCGGCTGAAGCAGG - Exonic
908105852 1:60841283-60841305 ACACACTGAGTGGCTGAAGAAGG - Intergenic
909290650 1:73878853-73878875 CCACACAGATTGGAAAGAGCTGG + Intergenic
911852776 1:102839654-102839676 CCAGATTGCTTGGCAAAAGCAGG + Intergenic
917295314 1:173512750-173512772 TCATACTGAATGGCAAAAGCTGG - Intronic
918696968 1:187556831-187556853 TCATATTGATTGGCAAAAGCTGG - Intergenic
921483684 1:215691935-215691957 CCAAACTCAGTGGCAGATGCAGG + Intronic
924078274 1:240363911-240363933 CCACACAAAGTGGCAGAGGCAGG - Intronic
1063819752 10:9820291-9820313 CCATACTTATTGGCTGCAGCAGG - Intergenic
1064569039 10:16673297-16673319 CCACACTTATTCTCAAAAGCAGG + Intronic
1065364203 10:24918881-24918903 CCACACTGCTTCCCAGAAGGAGG - Intronic
1066985786 10:42465451-42465473 CCACCCTGATATGCAGGAGCTGG + Intergenic
1067390200 10:45856641-45856663 CCACCCTGATACGCAGAAGCTGG + Intergenic
1067501272 10:46807229-46807251 TCACCCTGATATGCAGAAGCTGG - Intergenic
1067593305 10:47532689-47532711 CCACCCTGATATGCAGAAGCTGG + Intronic
1067640417 10:48040799-48040821 CCACCCTGATATGCAGAAGCTGG + Intergenic
1067873077 10:49979426-49979448 CCACCCTGATATGCAGAAGCTGG - Intergenic
1068053537 10:51982830-51982852 GCACACTCATTGGCTGCAGCAGG + Intronic
1070137376 10:73706836-73706858 CCACCCTGATATGCAGAAGCTGG + Intergenic
1070159324 10:73856268-73856290 TCACACTAAGTGGCAGAACCGGG + Intronic
1070278570 10:75031342-75031364 CCACATTGTTTAACAGAAGCAGG - Exonic
1071022773 10:81078485-81078507 TCATACTGATGGGCAAAAGCTGG - Intergenic
1071474858 10:86017501-86017523 CCAGCCTTATTTGCAGAAGCAGG + Intronic
1072207090 10:93214395-93214417 CCCCAAAGATTGGGAGAAGCTGG - Intergenic
1072549307 10:96465338-96465360 CCTCACTGATTGACTGGAGCAGG + Intronic
1074382848 10:112994260-112994282 CCACAGTGATTGCCAGGGGCTGG - Intronic
1075831560 10:125416405-125416427 CAGGACTGATTGGCAGAAGGGGG - Intergenic
1076721302 10:132394555-132394577 CCTCACTGACTGGCATGAGCAGG + Intergenic
1078738645 11:14045532-14045554 CCAGACTGAATGGCAGTGGCAGG - Intronic
1078886262 11:15503196-15503218 CCACACTGATAAGGAGAAGGAGG - Intergenic
1079120516 11:17680808-17680830 CTAGACTGATAGCCAGAAGCAGG - Intergenic
1079179519 11:18177145-18177167 CAAGCCTAATTGGCAGAAGCAGG - Intronic
1080052752 11:27873608-27873630 ACACACAGATTTGCAGAGGCAGG + Intergenic
1080749653 11:35140076-35140098 CCACACTGATTGGCAGAAGCAGG - Intronic
1080864446 11:36180790-36180812 CCACACCAATTGGCACACGCTGG - Intronic
1082209806 11:49485157-49485179 GCACACTGAGAGGCTGAAGCGGG - Intergenic
1084267792 11:68013863-68013885 CTGCTCTGATTGGGAGAAGCTGG - Intronic
1085200483 11:74698962-74698984 CCACGCTGATTCCCATAAGCAGG - Intronic
1086836589 11:91631833-91631855 CCACAAGGATGAGCAGAAGCAGG + Intergenic
1087129876 11:94659462-94659484 CCCCAGTGATAGGCAGAAGATGG + Intergenic
1087129989 11:94660461-94660483 TCACACTGAGAGGCAGATGCTGG - Intergenic
1087965066 11:104402963-104402985 CCAAGCTGATTAGCAGAAGGAGG - Intergenic
1088006825 11:104951150-104951172 CAACACTGATAGGCATAAGGAGG - Intronic
1089680366 11:120115877-120115899 CCACAGTGCTTGGCACAAGTGGG - Intronic
1089770150 11:120796855-120796877 CCACACTGATTGGGGTGAGCTGG + Intronic
1091850403 12:3692670-3692692 GCACACTTATTGGCTGCAGCAGG + Intronic
1096007413 12:48184106-48184128 CTCCATTGAGTGGCAGAAGCGGG - Exonic
1098148239 12:67519632-67519654 GCACACACATTGGCATAAGCAGG + Intergenic
1098231585 12:68376518-68376540 ACACATTGCCTGGCAGAAGCAGG + Intergenic
1100478164 12:94953026-94953048 GCACACAGATGGGCAGATGCAGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1102032721 12:109752376-109752398 AGGCACTGATTGGCAGCAGCAGG - Intronic
1102779904 12:115555252-115555274 CCACAATGAATGGTTGAAGCTGG + Intergenic
1106132858 13:26953910-26953932 CCACACAGGTTGCTAGAAGCAGG - Intergenic
1108512365 13:51167954-51167976 ACACACTGAGAGGCAGCAGCTGG - Intergenic
1109427266 13:62181415-62181437 CCTCACTGCTTGTCACAAGCTGG - Intergenic
1110936543 13:81297434-81297456 CCAGAATGATTGGTAGAAGTAGG + Intergenic
1111952879 13:94724066-94724088 CCAAACTGTTTGGTAGAAGAGGG - Intergenic
1112739828 13:102460025-102460047 TCACACTAAGCGGCAGAAGCTGG + Intergenic
1116506705 14:45691729-45691751 CCATTCTGATTGGCAGGAGACGG - Intergenic
1118138100 14:63049903-63049925 CCACACTGATTTCAAGGAGCAGG - Intronic
1120128238 14:80772702-80772724 GCACACAGATTGGCAGGTGCAGG - Intronic
1121436725 14:93925535-93925557 CCACCCTGACTGGTACAAGCAGG - Intronic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1123607512 15:22049281-22049303 CCACTCTGATTGGCATGAGATGG - Intergenic
1124014203 15:25862555-25862577 GCACAGTGATTGGCAGGGGCTGG - Intronic
1124662674 15:31563129-31563151 CCAGAGAGATTGGCAGAATCAGG - Intronic
1126506086 15:49406268-49406290 GCACACTCGTTGGCTGAAGCAGG + Intronic
1128519194 15:68364512-68364534 CCACCCGGAATGGCATAAGCAGG + Intronic
1202979747 15_KI270727v1_random:341060-341082 CCACTCTGATTGGCATGAGATGG - Intergenic
1132736211 16:1387407-1387429 CCACACTGAGGGTCTGAAGCAGG - Intronic
1141015030 16:80441129-80441151 CCTCAATGATGGGCAGAATCTGG - Intergenic
1143649772 17:8256303-8256325 CCACGTGGATGGGCAGAAGCTGG + Exonic
1146228767 17:31090507-31090529 CTGCACTGACTGGCAGATGCAGG - Intergenic
1147055082 17:37827932-37827954 CCACAGTGAGTGGCAGAGCCAGG + Intergenic
1147952019 17:44112656-44112678 CATCCCTGACTGGCAGAAGCTGG - Intronic
1147952041 17:44112727-44112749 CCACACCTATAGGCAGAGGCAGG + Intronic
1150639479 17:66939757-66939779 CCACACAGATTGGAAGTAGCAGG - Intergenic
1151500459 17:74484906-74484928 CCTCACTGAGTGGGAGAAGGTGG + Intergenic
1152305517 17:79518358-79518380 TGACACTGTTTGGGAGAAGCGGG + Intergenic
1152760165 17:82103488-82103510 CCACACTGGCTGGCAGAGGGTGG + Intronic
1160810905 19:1012569-1012591 CCACACTGCAGGGCAGAACCAGG + Exonic
1162804549 19:13130322-13130344 GCACTCTGAGAGGCAGAAGCAGG - Intronic
1163009156 19:14413846-14413868 CCACAGAGAGTGGGAGAAGCTGG - Intronic
1164297495 19:23925959-23925981 GCACACTGAAAGGCAGAGGCAGG - Intronic
1165762425 19:38329527-38329549 CTAAACTGCTTGTCAGAAGCTGG - Intergenic
926009881 2:9399564-9399586 CCACATTGGTTCCCAGAAGCAGG + Intronic
926990589 2:18676103-18676125 CCCCAATGATGGGCAGAAGTGGG + Intergenic
927047022 2:19289585-19289607 CCAAACTGATTAGCAGATACTGG + Intergenic
929868912 2:45741569-45741591 CCAATCTGATTGGTAGAAACTGG - Intronic
930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG + Intergenic
931911078 2:66901152-66901174 CCACACTTACTGGTAGAAACTGG - Intergenic
932224602 2:70029712-70029734 CCACTTTGCTTGTCAGAAGCAGG + Intergenic
933495341 2:83043600-83043622 TCATACTGAATGGCAGAAGCTGG - Intergenic
934721809 2:96583535-96583557 GCATGCTGAATGGCAGAAGCTGG - Intergenic
937318048 2:120944487-120944509 CCCCACTGATAAGCAGAATCTGG - Intronic
937827038 2:126378154-126378176 CTTCACTTATGGGCAGAAGCAGG + Intergenic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
938998321 2:136704219-136704241 ACACACTGAGTGGAAGAAGAAGG - Intergenic
941151386 2:161919265-161919287 GCACAATGAATGGCAGAAGGAGG + Intronic
944902607 2:204231019-204231041 CCACAGTGAATGGCAGAGCCAGG + Intergenic
947377478 2:229511211-229511233 CCCCACCCAGTGGCAGAAGCTGG + Intronic
949066905 2:241996709-241996731 CCAAACTCACAGGCAGAAGCAGG - Intergenic
1168970799 20:1929564-1929586 TCACACTGCTGGGCAGGAGCGGG - Intronic
1172014407 20:31864343-31864365 GCACAATGATGGGCAGCAGCAGG + Intronic
1172078712 20:32320546-32320568 CCAGTCTGATTGACAGAAGAAGG - Intronic
1175165417 20:57040309-57040331 CTAGAGTGATTGGCAGGAGCTGG + Intergenic
1177280341 21:18973840-18973862 TCATACTGAATGGCAAAAGCTGG + Intergenic
1178611836 21:34089505-34089527 CCAAACTTATTGGTAGAATCAGG + Intronic
950431239 3:12952431-12952453 CCACACAGGCTGGCAGATGCGGG - Intronic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951785548 3:26414725-26414747 CCACAGTGAAGGGCAGAAGCAGG + Intergenic
952311941 3:32198494-32198516 CCACAGGGATTGGCAGAGGTAGG + Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
957596241 3:82270500-82270522 TCAAACTGATGGGCAAAAGCTGG - Intergenic
959869967 3:111315182-111315204 CCAGATTGAATGACAGAAGCTGG + Intronic
962480489 3:135793997-135794019 CCCCACTGGCTGGCTGAAGCAGG + Intergenic
963227532 3:142877519-142877541 GCACAGTGCTTGGCACAAGCAGG - Intronic
963877738 3:150495294-150495316 AAACACTGAGTGGCTGAAGCTGG - Intergenic
964444673 3:156746262-156746284 CCCCACTGCTTGCCAGAAACAGG - Intergenic
965062021 3:163796108-163796130 CCACTTTGAGAGGCAGAAGCGGG - Intergenic
965261330 3:166489587-166489609 GCACACTGAATGGCAGAAGGAGG + Intergenic
966436922 3:179897105-179897127 CCACACATGTTGGCAGCAGCTGG + Intronic
967284976 3:187860193-187860215 TCATACTGAATGGCAAAAGCTGG + Intergenic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
969597211 4:8156285-8156307 CCACACTGATTGTCACTTGCTGG + Intronic
970221318 4:13814925-13814947 CAACACTGATTGGCTGAGGAGGG - Intergenic
973117307 4:46477510-46477532 TCATACTGAATGGCAAAAGCTGG + Intergenic
973259423 4:48146805-48146827 CCACACTGATTTCCAGTAGTTGG - Intronic
975249616 4:72163504-72163526 TCATACTGAATGGCAAAAGCTGG - Intergenic
975317362 4:72969998-72970020 AAACACTTATTGGCAGAAGCAGG + Intergenic
976588568 4:86826133-86826155 CAGCACTGAGAGGCAGAAGCGGG + Intronic
976912844 4:90328692-90328714 CCACACTGCAGGGCAGAAGTGGG - Intronic
978751228 4:112249742-112249764 CCACGCTGACTGGCACAAGATGG - Intronic
980540045 4:134181412-134181434 TCATACTGAATGGCAAAAGCTGG + Intergenic
980855762 4:138437683-138437705 CCACACTGAATGTCAAAAGAGGG + Intergenic
981599729 4:146472711-146472733 CACCACTGCTTGGCAGGAGCTGG - Intronic
982976413 4:162067597-162067619 TCATACTGAATGGCAAAAGCTGG + Intronic
984448736 4:179871870-179871892 CAACACTGCTGGGCAGGAGCTGG - Intergenic
985838970 5:2291422-2291444 CCACACCAATTCCCAGAAGCTGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
990618540 5:57533435-57533457 CCACACAGCTAGGCAGAAGAGGG + Intergenic
991029747 5:62070603-62070625 CCACACTGGTATGCAGGAGCAGG + Intergenic
991647659 5:68817622-68817644 CAGCACTGATTGACAGAGGCTGG - Intergenic
994592980 5:101795186-101795208 TCACACTGATGGGCAAAAGCTGG - Intergenic
994858719 5:105160290-105160312 TCACACTGAATGGGAAAAGCTGG - Intergenic
1000486513 5:161850866-161850888 GCACACTGACTGGAAGAAGGTGG + Exonic
1001576619 5:172768901-172768923 CCGCACTGTTCGGCAGAGGCTGG - Exonic
1001673099 5:173490814-173490836 CCAAACTGAATGGGAAAAGCGGG + Intergenic
1004090791 6:12498675-12498697 TCATACTGAATGGCAAAAGCTGG + Intergenic
1004101006 6:12611393-12611415 TCACGCTGAATGGGAGAAGCCGG + Intergenic
1004286342 6:14324414-14324436 CCACACTAATCTTCAGAAGCAGG + Intergenic
1007275341 6:40669184-40669206 CAAGTCTGTTTGGCAGAAGCTGG + Intergenic
1009266563 6:61562671-61562693 CCACAGTGATTGGAAGATGGGGG - Intergenic
1009684277 6:66936373-66936395 CCACACTGAATGGCACCTGCAGG - Intergenic
1013115805 6:107102911-107102933 CATCACTGAGTGGCAGAACCTGG + Intronic
1014655424 6:124097859-124097881 CTAGTCTGATTGGCAAAAGCTGG + Intronic
1016384915 6:143521490-143521512 CTATACTGAGTGGCAGAACCAGG + Intergenic
1016790018 6:148058630-148058652 CCATACTGAATGGCAAAAGCTGG - Intergenic
1016809785 6:148248847-148248869 CCTCACTGATTGTCAGAAGAAGG - Intergenic
1016970611 6:149758764-149758786 CCCCATTGATTGGCAGAGGAAGG + Intronic
1019204401 6:170347393-170347415 TCACACTGAGTTGCAGATGCAGG - Intronic
1020180727 7:5920392-5920414 CTACACTGAGTGGGAGAGGCGGG + Intronic
1020302203 7:6804490-6804512 CTACACTGAGTGGGAGAGGCGGG - Intronic
1022818778 7:33938461-33938483 ACACAAAGAGTGGCAGAAGCTGG + Intronic
1023174313 7:37420996-37421018 ACATACTGCATGGCAGAAGCAGG - Intronic
1026064006 7:67053270-67053292 CTAGTCTGACTGGCAGAAGCAGG + Intronic
1027422139 7:78027212-78027234 CTAAAGTGATTGTCAGAAGCAGG + Intronic
1028238338 7:88387879-88387901 CCACACTGATGGCAAGAAGGAGG - Intergenic
1028419875 7:90620905-90620927 CCACTGTGATGGGCAGAAGTGGG - Intronic
1029219592 7:98977675-98977697 CCACACTGAAGGGCAGACACAGG - Intronic
1029586506 7:101475484-101475506 CCCCACTGATGGAGAGAAGCAGG + Intronic
1031703050 7:124948869-124948891 TCATACTGAATGGCAAAAGCTGG + Intergenic
1036760123 8:11502932-11502954 CCACAGTGGCTGGCAGCAGCTGG - Intronic
1040581484 8:48702156-48702178 CCAGACTTCTTGGCAGAGGCTGG + Intergenic
1041775796 8:61521633-61521655 CCACAGTGAGTTGCAGATGCTGG - Intronic
1043496611 8:80807995-80808017 CCACACTGTTTGTCCGAAGCTGG - Intronic
1046450045 8:114377115-114377137 TCACACTGAAGGGCAAAAGCTGG + Intergenic
1049619603 8:143592094-143592116 CCAGGCTGATGGGCAGAGGCAGG + Intronic
1054782254 9:69175949-69175971 CCACAGTGACTGGCAGGAGTAGG - Intronic
1056900278 9:90592701-90592723 CAACACTGAGAGGCAGAGGCAGG - Intergenic
1062625238 9:137439463-137439485 CCACACTGAGTGGCAGGCGCGGG + Intronic
1189203584 X:39218729-39218751 CCACACTGGCAAGCAGAAGCTGG + Intergenic
1189947233 X:46191679-46191701 CCCCAATGATTGACAGAGGCAGG - Intergenic
1190056736 X:47185531-47185553 GCTCACCGACTGGCAGAAGCTGG + Exonic
1191096412 X:56677723-56677745 TCACACTGAATGGCAAAAACTGG + Intergenic
1191099900 X:56714733-56714755 GCACACTCATTGGCTGTAGCAGG - Intergenic
1191642778 X:63446286-63446308 CAACACTAATTGGAAGTAGCAGG + Intergenic
1192722225 X:73711158-73711180 CAACACTGGATGGCAAAAGCAGG - Intergenic
1193542812 X:82792353-82792375 TCATACTGAATGGCAGAAACTGG + Intergenic
1193710018 X:84868636-84868658 GCACACGGATGGGCAGATGCAGG + Intergenic
1194005698 X:88488707-88488729 TCATACTGAATGGCAAAAGCTGG - Intergenic
1196531878 X:116797405-116797427 CCATACTGACTGGCAGAAGATGG + Intergenic
1197089867 X:122523644-122523666 CCAAGCTGTCTGGCAGAAGCAGG - Intergenic
1198848221 X:140936572-140936594 TCACCCTGTTTGCCAGAAGCTGG - Intergenic
1198891178 X:141398468-141398490 TCATACTGAATGGCAAAAGCTGG - Intergenic
1199146892 X:144379431-144379453 GCACACTCATTGGCTGCAGCAGG + Intergenic
1199311148 X:146321151-146321173 CCATTCTGATTGGCATAAGATGG - Intergenic
1199674861 X:150180035-150180057 CCAGACTGGCTGGGAGAAGCAGG + Intergenic
1200010788 X:153119322-153119344 GCACACTGAGAGGCCGAAGCAGG - Intergenic
1200028812 X:153280600-153280622 GCACACTGAGAGGCCGAAGCAGG + Intergenic
1201304169 Y:12536647-12536669 CTGCACTGTTTGGCATAAGCAGG + Intergenic
1201597026 Y:15681495-15681517 GCACTTTGATTGGCTGAAGCTGG - Intergenic
1202112693 Y:21440270-21440292 TCATACTGAATGGCAGAACCTGG - Intergenic