ID: 1080757353

View in Genome Browser
Species Human (GRCh38)
Location 11:35214878-35214900
Sequence GGGGGGTCCCATACCACTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080757343_1080757353 -1 Left 1080757343 11:35214856-35214878 CCAAGACACATTCCACCCCAGTG 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1080757353 11:35214878-35214900 GGGGGGTCCCATACCACTCATGG 0: 1
1: 0
2: 0
3: 5
4: 61
1080757340_1080757353 25 Left 1080757340 11:35214830-35214852 CCTTCCTGATTGCTCATTACAGG 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1080757353 11:35214878-35214900 GGGGGGTCCCATACCACTCATGG 0: 1
1: 0
2: 0
3: 5
4: 61
1080757342_1080757353 21 Left 1080757342 11:35214834-35214856 CCTGATTGCTCATTACAGGAGAC 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1080757353 11:35214878-35214900 GGGGGGTCCCATACCACTCATGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080757353 Original CRISPR GGGGGGTCCCATACCACTCA TGG Exonic
900767196 1:4513399-4513421 GAGGGGTCACAGACCATTCAAGG + Intergenic
905970754 1:42140536-42140558 GGAGTGGCCCATTCCACTCATGG - Intergenic
910509274 1:87985318-87985340 GGGGGAGCCCAGGCCACTCATGG + Intergenic
910512576 1:88023270-88023292 GGGGTGGCCCAAACCATTCATGG + Intergenic
914358355 1:146908298-146908320 GGGAGGTCCCAGACCACCCTGGG + Intergenic
914495070 1:148188709-148188731 GGGAGGTCCCAGACCACCCTGGG - Intergenic
916627664 1:166575987-166576009 TGGGTGTGCCATACCACGCAGGG + Intergenic
922073935 1:222223410-222223432 GGGGTCTCCCAAACCACTCTAGG - Intergenic
1064318526 10:14280085-14280107 GGTGAGTCACATTCCACTCAAGG - Intronic
1075634280 10:124019755-124019777 GAGGGGTCCCATCTCTCTCAGGG + Intronic
1076812224 10:132893148-132893170 AGGTGGTCCCTTACCAGTCACGG - Intronic
1077009441 11:373657-373679 GGTGGCTCCCACACCCCTCAGGG - Intronic
1077217636 11:1401642-1401664 AGGGGCTTCCATACCACCCACGG - Intronic
1077836760 11:5933092-5933114 CGGGGGTTCCTTACCACTAAAGG + Intronic
1079349353 11:19679662-19679684 GGGGTGTCCCAAACCACCCTAGG - Intronic
1080757353 11:35214878-35214900 GGGGGGTCCCATACCACTCATGG + Exonic
1083294985 11:61710353-61710375 GGGGGGACCGCTACCTCTCAGGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1102160323 12:110763630-110763652 GTGGGCACCCATTCCACTCACGG - Intergenic
1121606780 14:95246428-95246450 GGGGGGTGCCACACCATGCAGGG - Intronic
1123779042 15:23607244-23607266 CGGGGGTCCCATAAGACTAATGG + Intronic
1129388738 15:75209975-75209997 TGAGGGTCCCACATCACTCAGGG + Intronic
1131510074 15:93044929-93044951 GGGCGGTCCCAGCCCACACATGG + Exonic
1143652291 17:8270924-8270946 GAGGAGTCCCATACTGCTCAGGG - Intergenic
1144683586 17:17211510-17211532 AGGGGGTCCCCTCCCACTCGAGG + Intronic
1144955833 17:19018355-19018377 GCTGGGTCCCATGCCCCTCAAGG + Intronic
1154196904 18:12273501-12273523 GGGGGGTCTCCTCCCACCCAGGG + Intronic
1161321172 19:3642198-3642220 GGAGGGTCACATCCCACCCAGGG + Intronic
1162791216 19:13064058-13064080 GGGGGGTCCCATCCCAGCAAGGG - Intronic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
928388360 2:30888891-30888913 GGGGGGGACAATACAACTCATGG - Intergenic
934859015 2:97748679-97748701 GCGGGGTTCCCTCCCACTCAGGG + Intergenic
937368128 2:121279820-121279842 GAGGGGTATCATACCAGTCAGGG + Intronic
937998924 2:127716536-127716558 GGGGGGTCCCACCCATCTCAGGG + Intronic
947498877 2:230658118-230658140 GGGGAGCCCCATACCACTGAAGG - Intergenic
948061106 2:235043876-235043898 GGGGGGCCCCAGACAACCCAAGG + Intronic
1169979803 20:11371663-11371685 GTGGGGTCCCACATCAGTCAAGG - Intergenic
1171192138 20:23166248-23166270 GGGGGGCCCCAGAGCACACAGGG + Intergenic
1172626628 20:36351106-36351128 GGGGGGCCCCCAACCACTCCTGG - Intronic
1174413819 20:50353725-50353747 GGGAGGTCCCAGACCAGGCAGGG + Intergenic
1179399196 21:41068875-41068897 GGGGTATCCAATACCACTCAAGG - Intergenic
1181902336 22:26166992-26167014 GGGGGGTCCCAACCCAGCCAAGG - Intergenic
954685281 3:52366879-52366901 GGGGGGTCACTCACCACTCATGG - Exonic
960825204 3:121775535-121775557 GATGGGTCCCAAACCACCCATGG + Intronic
961522886 3:127477616-127477638 GGGGCCTCCCGTCCCACTCAGGG - Intergenic
964765338 3:160173675-160173697 GAGGGATGCCATGCCACTCAGGG - Intergenic
965913185 3:173807693-173807715 TGGGGGTCCCAAACCAGTGATGG + Exonic
969226531 4:5802086-5802108 GGGGGGTCCCGTACCCTGCAGGG - Exonic
970443936 4:16108671-16108693 TGGGGGTCCCCCACCACTCAGGG + Intergenic
971170087 4:24225082-24225104 GGGGCTCCCCATATCACTCAGGG - Intergenic
986259872 5:6134799-6134821 GGGGGGTGCCTTACTACTAAGGG + Intergenic
990774781 5:59293816-59293838 TGGGAGTCACATACCACTGAAGG + Intronic
995297725 5:110539895-110539917 GGGAGGTCCCAAACCACATATGG - Intronic
1001118434 5:168958897-168958919 AAGGGGTACCATACCACTCATGG - Intronic
1019428008 7:986467-986489 GGGGGGACCCTTAGCCCTCAAGG - Intronic
1025256717 7:57388846-57388868 GGGAGGTCCCAGACCAGGCAGGG - Intergenic
1029643893 7:101839275-101839297 GGGGGGTCAGATACCACCGAGGG - Intronic
1032484028 7:132269476-132269498 GTGGTGTCCCATGCCACTCTAGG - Intronic
1034497233 7:151430357-151430379 CGGGGGTCCCACAGCAGTCATGG + Intronic
1036566017 8:9938557-9938579 GGAGGGTGCCTTACCACTCCAGG - Intergenic
1039465308 8:37781251-37781273 GGGGAGGCCAATCCCACTCATGG - Intergenic
1045361754 8:101439405-101439427 GCGAGGCCCCATACCAGTCAGGG - Intergenic
1049535449 8:143178521-143178543 GGTGGGTCCCATAGCAGTCTGGG + Intergenic
1053302785 9:36963635-36963657 GGCGGCTTCCAGACCACTCAGGG + Intronic
1060448868 9:123718255-123718277 GGGGGCTCCCAATCCACCCAGGG + Intronic
1196375716 X:115030559-115030581 GGGGGTTCCATTACCACTGAAGG - Intergenic
1198228772 X:134670207-134670229 GGGTGGTCCCATGCCACCCTGGG + Intronic