ID: 1080760020

View in Genome Browser
Species Human (GRCh38)
Location 11:35239916-35239938
Sequence AACCCAGGGGAAACCCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080760015_1080760020 10 Left 1080760015 11:35239883-35239905 CCTGGAGGTGGTGAGATGTGCTT No data
Right 1080760020 11:35239916-35239938 AACCCAGGGGAAACCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080760020 Original CRISPR AACCCAGGGGAAACCCAGTG TGG Intergenic
No off target data available for this crispr