ID: 1080760859

View in Genome Browser
Species Human (GRCh38)
Location 11:35247653-35247675
Sequence TGGAAGGAGGTGCCCACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080760852_1080760859 30 Left 1080760852 11:35247600-35247622 CCTGTGGTTCTTTGACGTACAGA No data
Right 1080760859 11:35247653-35247675 TGGAAGGAGGTGCCCACACTAGG No data
1080760854_1080760859 -3 Left 1080760854 11:35247633-35247655 CCTGTTTATGACATTGTGCCTGG No data
Right 1080760859 11:35247653-35247675 TGGAAGGAGGTGCCCACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080760859 Original CRISPR TGGAAGGAGGTGCCCACACT AGG Intergenic
No off target data available for this crispr