ID: 1080761516

View in Genome Browser
Species Human (GRCh38)
Location 11:35254582-35254604
Sequence ACAGTGCCCCAGAAGGAGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080761513_1080761516 9 Left 1080761513 11:35254550-35254572 CCAGGCAGGCAAAATGGTTGCCA 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG 0: 1
1: 0
2: 3
3: 30
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080761516 Original CRISPR ACAGTGCCCCAGAAGGAGTG AGG Exonic
900948958 1:5846818-5846840 ACAGCGCCCCTGGAGTAGTGTGG + Intergenic
900980811 1:6045143-6045165 TCAGTGCCCCAGTCGCAGTGTGG - Intronic
901492058 1:9601685-9601707 ACAGAGCCCGAGGAGGAGAGAGG - Intronic
901626116 1:10626046-10626068 ACAGTGCTCCAGTAGGAGTTTGG - Intronic
901818191 1:11806718-11806740 TCAGTGACCCAGAAAGGGTGAGG - Intronic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903425670 1:23252448-23252470 ACTGTGGCCTGGAAGGAGTGGGG + Intergenic
903686109 1:25133187-25133209 AGAGTGTCCCATAATGAGTGAGG - Intergenic
905975614 1:42171637-42171659 GCAGTGCCCCAGAAGGGCAGGGG + Intergenic
910624467 1:89291840-89291862 ACAGTGTCCCAGAAGGGGTCAGG - Intergenic
911758077 1:101583541-101583563 AAAGTTGCCCAGAAGGAGAGAGG + Intergenic
912707773 1:111927690-111927712 ACAGTGCCCAGCATGGAGTGAGG - Intronic
913078938 1:115364152-115364174 ACATGGCACCAGAGGGAGTGTGG + Intergenic
913136339 1:115893178-115893200 GCAGGGCCCCAGGAGCAGTGGGG - Intergenic
914814447 1:151053193-151053215 ACAGTGCCTCACAAGGCTTGGGG - Exonic
915436028 1:155907136-155907158 AGAGTGCACCAGATGTAGTGAGG + Intronic
916696011 1:167237204-167237226 ACAGTGACCTTGAAGGAGAGAGG + Intronic
917083532 1:171281883-171281905 AGAGAGCCCCAGAATGAGAGAGG + Intronic
920219352 1:204385170-204385192 ACAGTTCCCCAGAGGGAGAGGGG + Intergenic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
923800210 1:237201733-237201755 AGAGAGCCACAGGAGGAGTGAGG - Intronic
1065837171 10:29669194-29669216 GCAGAGCCCCAGAAGAATTGGGG + Intronic
1065917647 10:30366301-30366323 AGAGAGCCCCAGAAGGAAAGGGG - Intronic
1067067891 10:43113796-43113818 ACAGAGGCCCAGAGGGAGGGAGG - Intronic
1068897870 10:62227573-62227595 ACCGTGCCCCACCAGGACTGTGG - Intronic
1070838707 10:79468393-79468415 ACAGTTCCCAAGAAGGGGAGGGG + Intergenic
1071111457 10:82162518-82162540 ACTCTGCCCAAAAAGGAGTGGGG - Intronic
1075463271 10:122632596-122632618 CCCCTGCCCCAGATGGAGTGGGG - Intronic
1076171506 10:128323893-128323915 TCATTGCACCAGAAGGAGCGTGG + Intergenic
1076327854 10:129642291-129642313 CCATTGCCCCAGAAACAGTGGGG + Intronic
1076474913 10:130745156-130745178 ACAGAGCCCCTGACGGCGTGAGG + Intergenic
1076590171 10:131577327-131577349 AAAGTGCCTCAGAAGGATGGTGG + Intergenic
1077300676 11:1845714-1845736 AAGGTGCCCCAGAGGGTGTGGGG + Intergenic
1078103335 11:8343149-8343171 ACAGAGCCCCAGTGGGAGCGTGG + Intergenic
1078327788 11:10394453-10394475 ACGGAGGCCTAGAAGGAGTGAGG - Intronic
1078530100 11:12130592-12130614 ACAGTGTCCCAGCAGGCATGAGG + Intronic
1078850384 11:15157872-15157894 ACAGGGCCACAGCAGAAGTGGGG - Intronic
1080271487 11:30455273-30455295 CCAGTGCCTCAGCAGGAATGGGG - Intronic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1080787136 11:35485765-35485787 ACAGAGCCTTAGAAGGAGGGAGG - Intronic
1081194203 11:40141375-40141397 TCAGTGCCACAGGAGTAGTGGGG - Intronic
1083662244 11:64256820-64256842 ACTGTGCCCCAGGAGGAGTGGGG - Intronic
1084457232 11:69274917-69274939 TCAGTGAGCCAGCAGGAGTGGGG + Intergenic
1084509503 11:69594453-69594475 ACAGTGAGCCTGAAGGAATGGGG + Intergenic
1085218401 11:74851934-74851956 CCAGTGCCCAAGGAGCAGTGTGG - Intronic
1087058362 11:93955185-93955207 CCAGAGCACCAGAGGGAGTGTGG + Intergenic
1087994545 11:104787782-104787804 ACAGTGATCCAGAAAGACTGAGG - Intergenic
1088510700 11:110571025-110571047 ACATTGTCCCAGGATGAGTGTGG - Intergenic
1090192469 11:124783181-124783203 ACAGTTCCCCACAAAGACTGAGG - Intronic
1090421918 11:126581109-126581131 TCAGTGCCCCAGAAGCTCTGGGG + Intronic
1090453094 11:126823807-126823829 ACAGTGCCCCAGGTGAAGTAGGG + Intronic
1090591743 11:128278479-128278501 TCAGAGTCCCAGAAGGAGAGGGG - Intergenic
1090941580 11:131392438-131392460 ACAGAGCCCCTGAAGGGATGGGG + Intronic
1091317299 11:134623661-134623683 TCAGTGCTCCAGAAGGACTGAGG - Intergenic
1092475963 12:8819350-8819372 ACAATGCCCCATAAAGAGTTCGG - Intergenic
1092940421 12:13402620-13402642 ACAATGGCCCAGAAGCAGGGAGG + Intergenic
1093831311 12:23762370-23762392 ACATTGCCCAGGCAGGAGTGTGG - Intronic
1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG + Exonic
1096217816 12:49808276-49808298 AGAGTGCCCCAGCTGGAGTGGGG + Intronic
1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG + Intergenic
1098991383 12:77067707-77067729 CAAGAGCCCCAGAGGGAGTGTGG - Intergenic
1100021047 12:90070016-90070038 ACAGTGGACCAGAATGAGTGAGG - Intergenic
1102368939 12:112364899-112364921 ACAGAGCCCTAGAAGGCTTGTGG + Intronic
1103022054 12:117541826-117541848 TCACTGACCCAGAAGCAGTGTGG - Intronic
1103158753 12:118709714-118709736 ACAGTGCACCAGACTGAGTACGG - Intergenic
1104304755 12:127599687-127599709 ACGGTGCCCCAGAAGGGATTGGG - Intergenic
1104548999 12:129738919-129738941 ATAATGATCCAGAAGGAGTGAGG + Intronic
1105209423 13:18249089-18249111 TCTGTGGCCCAGAAGGAGAGGGG + Intergenic
1105823497 13:24100838-24100860 AGAGTTCACCAGAAGGAGGGTGG - Intronic
1107067804 13:36234381-36234403 TGAGTGTCCCAGAAGGAGAGGGG + Intronic
1112415018 13:99196960-99196982 AGAGAGACCCAGAAGGAGTCAGG - Intergenic
1116740422 14:48747298-48747320 ACAGCCCCCTAGAAGGAGAGAGG - Intergenic
1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG + Intronic
1119503202 14:75148638-75148660 ACAGTGCCACTGAAGCACTGGGG + Intronic
1119747520 14:77054772-77054794 AGGGTGCCCCAAAATGAGTGGGG + Intergenic
1120715352 14:87835485-87835507 ACAGTTCACCAAAAGCAGTGAGG + Intergenic
1121815035 14:96922744-96922766 AGAGTGAGCCAGAAGGAGAGAGG - Intronic
1122718489 14:103709017-103709039 ACAGTGCTCCAGAAGGGGGCAGG + Intronic
1131223568 15:90605656-90605678 ACAGTGCAACAGAAAGAGCGTGG - Intronic
1131638545 15:94264062-94264084 ACTGTGACCAAGAAGAAGTGAGG - Intronic
1132120145 15:99169127-99169149 TCTGTGCCCCACAGGGAGTGAGG - Intronic
1134467978 16:14495811-14495833 ACAGAGGCACAGAAGGAGGGAGG + Intronic
1135955881 16:26955831-26955853 GCAGTGCCTCAGAGGGGGTGGGG + Intergenic
1142127457 16:88417246-88417268 ACAGTGGCTCAGAAAGGGTGTGG - Intergenic
1142317140 16:89354943-89354965 AAAATGCCCCCAAAGGAGTGAGG + Intronic
1142580041 17:936337-936359 GCAGTGCCTCAGAGGGAGGGCGG - Intronic
1143121170 17:4607928-4607950 GCAGTGGCCCAGAGGGAGGGAGG - Exonic
1143616111 17:8050693-8050715 ACAGTGCCTCAGAAAGGGTAGGG + Intergenic
1144132900 17:12265451-12265473 CCAGTGCCTCAGAGGGAGTGTGG - Intergenic
1145042221 17:19585425-19585447 ACCGTGCCCCAGGAGGGCTGTGG - Intergenic
1145248240 17:21283829-21283851 ACCGTGTCTCAGAGGGAGTGAGG - Intergenic
1145802872 17:27701380-27701402 AGAGTGCTCAAGAAGGAGTATGG + Intergenic
1146314040 17:31793340-31793362 ACAGTCCCGCAGAAGGAGGGAGG + Intergenic
1147400237 17:40176660-40176682 ATGCTGCCCCAGAAGGAGTGTGG - Intergenic
1147574860 17:41593284-41593306 AGACTGCCCCAGAAGTAGTGGGG + Intergenic
1148051787 17:44773137-44773159 ACAGTGCCCCCTAATGTGTGTGG - Intronic
1149536560 17:57438121-57438143 ACAGTGCACCAGTAGAGGTGGGG + Intronic
1151140782 17:71990206-71990228 GCAGTGACCCAGAGGCAGTGGGG - Intergenic
1151534148 17:74729328-74729350 ACAGTGGCCGAGAAGGAGCCGGG - Intronic
1151551554 17:74825239-74825261 ACAGTGGCCCAGTTGGAGGGTGG - Intronic
1153786009 18:8536351-8536373 ACAGTGCCCCTGGAGGTGTGGGG + Intergenic
1157493395 18:48139094-48139116 ACAGGGCTACAGGAGGAGTGGGG + Intronic
1159959136 18:74541811-74541833 ACAGTGCTTCTGAAGAAGTGGGG - Intronic
1161744541 19:6047678-6047700 ACTGTCCCACAGAAGGAGAGAGG + Intronic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1164309004 19:24030187-24030209 ACTGTCCCCCAGAACAAGTGGGG - Intergenic
1165418954 19:35713305-35713327 ACAGTCCCCCCGAAGGGGTGTGG - Intronic
1166792284 19:45405349-45405371 ATAGTGCGCCTGAAGGGGTGGGG - Intronic
1167428313 19:49441029-49441051 ACAGAGACCCAGAAGTGGTGGGG + Intronic
1167446841 19:49542902-49542924 ACGGAGCCCCAGAAAGAGAGGGG + Intronic
1167465652 19:49649940-49649962 ACAGTGCCAGGGAAGGAGAGGGG - Intronic
1167475925 19:49700974-49700996 ACAGAGACCCAGAAAGAGAGGGG - Intronic
1167631080 19:50626581-50626603 ACAGAGGCCCAGAAAGAGAGGGG + Intronic
1168549955 19:57284581-57284603 ACATTTACCCAGGAGGAGTGGGG + Exonic
1168554106 19:57323712-57323734 ACATTCACCCAGGAGGAGTGGGG + Exonic
925124206 2:1442302-1442324 ACAGTCCTCCAGAGGCAGTGGGG + Intronic
925823354 2:7822519-7822541 ACAGTGGTCCAGGAGGACTGTGG - Intergenic
927358970 2:22209158-22209180 ACAGTGCAAGAGGAGGAGTGTGG + Intergenic
927895118 2:26776495-26776517 ACAGGGGCCTGGAAGGAGTGGGG + Intronic
928071621 2:28222930-28222952 ACACTTCCCCAGACAGAGTGCGG - Intronic
929171207 2:38934681-38934703 ACAGTGCCTGAGATGGAGGGAGG - Intronic
933345293 2:81077384-81077406 ACAGTGCCACTGAAAGAGGGAGG - Intergenic
933553316 2:83802694-83802716 CCACTGGCCCAGAAGGATTGAGG - Intergenic
933742879 2:85548552-85548574 ACACTGTCCAAGGAGGAGTGGGG + Exonic
935736013 2:106107212-106107234 ACAGTGGCCCTGACTGAGTGTGG - Intronic
937431910 2:121845939-121845961 ACAGTCTGCTAGAAGGAGTGCGG + Intergenic
939291084 2:140195500-140195522 ACAGGGCTACAGAAGGTGTGTGG - Intergenic
941776128 2:169395645-169395667 ACACTGCTCCAGAAGGCCTGGGG + Intergenic
947777021 2:232721097-232721119 ACAGTGCCTCTGAAGGAATGTGG - Intronic
947951610 2:234152642-234152664 GCAGTGCCCCAGTAGATGTGTGG + Intergenic
948572142 2:238924450-238924472 ACAGTGCCCCAGGCGGACTTGGG + Intergenic
1169661511 20:7983395-7983417 ACCTGGCCCCAGAAGAAGTGTGG + Intronic
1171398797 20:24858315-24858337 ACAGTGCCCCACAAAGAGGGGGG + Intergenic
1172146527 20:32762084-32762106 AAAAGGCCCCAGAAGGAGTCTGG + Intergenic
1173912919 20:46683692-46683714 ACAGGGACCCACAAAGAGTGAGG - Intronic
1174361371 20:50030852-50030874 AGAGAGCCACAGAAGGAGCGAGG + Intergenic
1174574286 20:51525778-51525800 ACAGAGCCACAGAGGAAGTGGGG - Intronic
1175227391 20:57452551-57452573 GCAGTGAACAAGAAGGAGTGTGG + Intergenic
1175760703 20:61560753-61560775 GCAGTGCCCCAGAAGGAGCCCGG + Intronic
1181105732 22:20574065-20574087 ACAGAGCTCCAGCAGGAGAGTGG - Intronic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1182813106 22:33134664-33134686 CCAGGCCCCCAGAAGAAGTGGGG + Intergenic
1183418747 22:37697775-37697797 ACAGAGCCCCAGGGGGAGGGTGG - Intronic
949229501 3:1734134-1734156 ATCGTGCCCCAGAAACAGTGTGG + Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950443889 3:13025166-13025188 AAGGAGCCCCAGAAAGAGTGGGG + Intronic
950672739 3:14536964-14536986 ACAGTGCCCAAGTGGCAGTGTGG - Intronic
952078789 3:29731810-29731832 AGAGTGCACGAGAGGGAGTGAGG - Intronic
953727726 3:45415167-45415189 ACTGTGGCCCAGCAGGAGTGAGG - Intronic
953790575 3:45944929-45944951 ACAGTGCCCCAGAGAGCTTGTGG + Intronic
954152192 3:48663099-48663121 ACAGCGCCCTAGAAGGAGGGAGG - Intergenic
954414505 3:50386566-50386588 ACAGGGCCCGAGACGGAGCGGGG - Intronic
955875771 3:63488979-63489001 ACACTTCCCCAAAAGGAGAGTGG + Intronic
960626488 3:119686694-119686716 GCAGTGCCCCAGTAGGTGTAGGG + Intergenic
960918996 3:122727422-122727444 CCAGTATCCCAGAAGGACTGAGG + Intronic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
964887591 3:161502606-161502628 ACTGAGACCCAGAACGAGTGAGG - Intronic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
968420126 4:477028-477050 ACAAGGCCCAAAAAGGAGTGAGG - Intronic
968582571 4:1401895-1401917 TCAGAGCCCCAGAAAGGGTGGGG - Intergenic
968742783 4:2339873-2339895 ACAGGGCCCCAGGAGCAGGGAGG + Intronic
969228522 4:5814423-5814445 CCAGGGCCTCAGAAGGAATGTGG - Intronic
969636013 4:8369938-8369960 ACACAGCCCCATAAGCAGTGGGG + Intronic
969691518 4:8706585-8706607 CCAGGGCCCCAGAGGGAGCGGGG + Intergenic
969938727 4:10708829-10708851 ACAGTGTCACAGAAGGAGCACGG + Intergenic
972581605 4:40400115-40400137 CCACTGCTCCAGAAGGAGTTGGG + Intergenic
973295724 4:48518609-48518631 ACAGTGAACAAGAAGGAGAGGGG - Intronic
974761726 4:66285322-66285344 ACAGAGCCCCAGAAGGTGGCAGG + Intergenic
975735647 4:77378428-77378450 TCAGAGCCCCAGAAGGAGGGAGG + Intronic
977574293 4:98659641-98659663 AAAGTGCTCCAGGAGGAGGGCGG - Intergenic
978828272 4:113050581-113050603 ACAGTTTACCAGAAGGAGTCAGG - Intronic
979059946 4:116044643-116044665 ACAGTGCCCCAGGGGTAGGGAGG + Intergenic
983528412 4:168784396-168784418 ACAGTGCCACTGCAGGAGTGAGG + Intronic
986024956 5:3842078-3842100 CCAGTTCCCCAGAAGGAAGGAGG - Intergenic
986387305 5:7247385-7247407 ACAGTGCCTCACAAGGAGTAGGG - Intergenic
986822919 5:11488026-11488048 ACAGTGGCTGAGAATGAGTGTGG - Intronic
989989298 5:50742366-50742388 ACAAAGCCCCAAATGGAGTGTGG + Intronic
991515428 5:67429632-67429654 ACAATGCCCCAGAAGAAGAGAGG - Intergenic
994093160 5:95826164-95826186 AGATTGCCCCAGCAGCAGTGTGG - Intergenic
995255143 5:110037211-110037233 TCAGAGACCCAGAAGGAGTAAGG - Intergenic
996981221 5:129497658-129497680 ACAGTGGCACAGAAGAATTGAGG - Intronic
999437846 5:151577944-151577966 AGAGAGCCCCAGAAGAAGTGGGG - Intergenic
1003150290 6:3542403-3542425 ACAGTGCCTCAGAAGGTCTCTGG - Intergenic
1003217985 6:4132484-4132506 ACCTTGCCCCAGAAGAGGTGTGG - Intronic
1016614461 6:146029698-146029720 AAAGTGCCCGAGAGGAAGTGTGG + Exonic
1016990359 6:149924250-149924272 ACAGTGCCCCACCAGGTGTGGGG + Intergenic
1018060459 6:160085961-160085983 ACACTGCCCCAGAAGGGGGAAGG + Intronic
1018367663 6:163138038-163138060 ACAGTACATAAGAAGGAGTGGGG + Intronic
1018696380 6:166394809-166394831 ACAAGTCCCCAGAAGGAGAGAGG + Intergenic
1018954209 6:168397156-168397178 ACAGAGCTCCAGAAGGAGTGCGG + Intergenic
1019100499 6:169625749-169625771 CCAGAGCCCCAGACGGAGTAGGG - Intronic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022514089 7:30964449-30964471 ACAGTGCCTCAGAATTGGTGAGG + Intronic
1023635006 7:42200736-42200758 ACAGTGCCCAAGAAGTCGTGAGG - Intronic
1024633494 7:51268122-51268144 ACAGTGCCCCAGACGGCACGTGG - Intronic
1031983746 7:128148750-128148772 ACAGTGTCCCGTAAGGAGTGAGG - Intergenic
1033134756 7:138775116-138775138 AAGGTACCCCAGAATGAGTGAGG + Intronic
1034410799 7:150941150-150941172 ACATTGCCAGTGAAGGAGTGGGG + Intergenic
1034907403 7:154962757-154962779 AAAGTGCCCCATAAGGACAGAGG + Intronic
1035133670 7:156678595-156678617 ACACTGACCAAGAAAGAGTGGGG + Exonic
1035320932 7:158028854-158028876 AGCGTGCACCAGAAGGAGGGAGG + Intronic
1035733481 8:1870021-1870043 ACAGGGGCCCGGAGGGAGTGGGG + Intronic
1035957776 8:4101359-4101381 TCAGGGCCCCAGATGGAATGTGG - Intronic
1036469808 8:9042574-9042596 ACAAAGCCCCAGAAGGCCTGCGG - Intronic
1038520639 8:28229483-28229505 ACATTGCCCCAAAAGGAAAGAGG + Intergenic
1042569476 8:70147063-70147085 CCATTGCCCAAGAAAGAGTGAGG + Intronic
1044959690 8:97518170-97518192 AGAATGCCCGAGAGGGAGTGTGG - Intergenic
1045393053 8:101734089-101734111 GCAGTGCCCCAGGAGCAGGGAGG + Intronic
1045510312 8:102807942-102807964 ACAGTGGCCCAGGAGGACCGAGG + Intergenic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1051621583 9:19055354-19055376 GCAGGGCACCTGAAGGAGTGAGG + Exonic
1053223257 9:36328816-36328838 ACATTGCTCAAGAAGGAATGAGG + Intergenic
1053416996 9:37953112-37953134 CCAGAGGCCCAGAAGGAGAGTGG + Intronic
1055584678 9:77745894-77745916 AAAGGGCCCCAGAAGGGCTGGGG + Intronic
1055943148 9:81669329-81669351 CGAGTGGCCCAGAAGGAGGGAGG - Intronic
1057216918 9:93234251-93234273 ACAGTGTCCCTGAATGAGGGTGG - Intronic
1057777579 9:98023373-98023395 ACATTGCCTTATAAGGAGTGGGG - Intergenic
1059451095 9:114371924-114371946 ACAGAGGTCCAGATGGAGTGAGG + Intronic
1060404869 9:123368212-123368234 AGTGTGCCCCAGCAGGAATGCGG - Intronic
1060717891 9:125951297-125951319 ACAATAGCCCAGCAGGAGTGTGG + Intronic
1062058850 9:134483739-134483761 ACTGTGCCCCAGGAGGTGTGTGG + Intergenic
1185826249 X:3253984-3254006 TCAGTGCCAGAGAAGGAATGAGG + Intergenic
1186543635 X:10426221-10426243 TCAGTTTCCCAGAAGTAGTGTGG - Intergenic
1192112204 X:68376555-68376577 GCAAGGCCACAGAAGGAGTGTGG + Intronic
1193029088 X:76878886-76878908 GCAGTGCCCCAGTGGAAGTGGGG + Intergenic
1196501009 X:116382182-116382204 ACCGTGCCCATGAAGAAGTGAGG + Intergenic