ID: 1080762390

View in Genome Browser
Species Human (GRCh38)
Location 11:35264388-35264410
Sequence TGAACCCAGCCAGAGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080762390_1080762391 0 Left 1080762390 11:35264388-35264410 CCAGAGATCTCTGGCTGGGTTCA 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1080762391 11:35264411-35264433 GCTTGTCCTCAGCTGCTGTGTGG 0: 1
1: 0
2: 1
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080762390 Original CRISPR TGAACCCAGCCAGAGATCTC TGG (reversed) Intronic
900210169 1:1451659-1451681 TGAACCCCGCCTGTGAGCTCAGG - Intronic
900215718 1:1480480-1480502 TGAACCCCGCCTGCGAGCTCAGG - Intronic
900220172 1:1504299-1504321 TGAACCCCGCCTGTGAACTCAGG - Intergenic
902201840 1:14839225-14839247 TGAACCCAGACAGAACACTCCGG - Intronic
902722763 1:18315071-18315093 TCACTCCAGCCACAGATCTCTGG - Intronic
902815540 1:18914420-18914442 TGGACCCAGCCTGGGATCTCCGG + Intronic
903133111 1:21291838-21291860 TGAACCCAGCCAGATTTCTGTGG - Intronic
904279666 1:29409900-29409922 GGACCCCAACCAGAGTTCTCTGG + Intergenic
904795544 1:33053614-33053636 TGAACCAAGGCAGAGACATCCGG + Intronic
904899253 1:33843651-33843673 TAATGCCAGCCAGAGATCCCAGG + Intronic
905113199 1:35613240-35613262 TCAGCCAAGCCAGAGATCTTTGG - Intronic
905615266 1:39392871-39392893 TCAAACCAGGCAGAGATCTCAGG + Intronic
907260521 1:53214861-53214883 TGAACAGAGCCAGATAGCTCAGG + Intronic
908356803 1:63330217-63330239 AGGACCCAGCCTGGGATCTCTGG + Intergenic
910234283 1:85019464-85019486 TGGACCCAGAAAGAGAGCTCAGG - Intronic
911949455 1:104153997-104154019 TGAAGCAAGACACAGATCTCTGG + Intergenic
915316500 1:155031758-155031780 TGTCCCCAGCCAGGGCTCTCCGG - Exonic
916124057 1:161553588-161553610 TGAATCCATCCAGAGATCCTAGG + Intergenic
916133940 1:161634950-161634972 TGAATCCATCCAGAGATCCTAGG + Intronic
916267435 1:162904760-162904782 GGCACCAAGCCAGAGATCACAGG - Intergenic
917716073 1:177739421-177739443 AGAACCCAGCCCCACATCTCTGG + Intergenic
920416085 1:205800175-205800197 TGAAGCCAGCCTGCGATCCCAGG + Intronic
921179716 1:212622380-212622402 TGAACCCAACCAGAGGTTACGGG - Intergenic
924378683 1:243440051-243440073 AGAACCCAGGCAGAAAGCTCCGG - Intronic
924567940 1:245213467-245213489 TGAACTCCACCAGCGATCTCTGG - Intronic
924631576 1:245745639-245745661 AGATGCCAGCCAGAGCTCTCCGG + Intergenic
1062894454 10:1092213-1092235 CGCACCCAGCCAGAGGTCTGAGG - Intronic
1063237749 10:4136004-4136026 TTTAGCCAGCCAGAGATCACTGG + Intergenic
1065478874 10:26172160-26172182 TGACCACTGCCAGAGATCTGCGG + Intronic
1073491711 10:103856781-103856803 AGAACCCAGGCACAGATCTAAGG + Intergenic
1074860393 10:117505721-117505743 AGTACCCAGCCTCAGATCTCTGG + Intergenic
1075444236 10:122502796-122502818 AGAGCCCAGGCGGAGATCTCAGG - Intronic
1075464444 10:122641152-122641174 TGGCCCCAGCCTGACATCTCTGG - Intronic
1076527941 10:131124161-131124183 TGGACCATCCCAGAGATCTCTGG + Intronic
1076612856 10:131737340-131737362 TGAACCCAGGCACTGATCCCTGG + Intergenic
1077865222 11:6216689-6216711 TGAACTCAGTCAGGGAGCTCAGG + Intronic
1078402152 11:11037954-11037976 TGAACCCAGACCCAGGTCTCTGG + Intergenic
1079837430 11:25351346-25351368 TGCTCCCAGCCTGAGAGCTCAGG + Intergenic
1080762390 11:35264388-35264410 TGAACCCAGCCAGAGATCTCTGG - Intronic
1083133110 11:60646043-60646065 TGAGCCCAGCCAGAGATTCTTGG + Intergenic
1084142116 11:67239657-67239679 TGCAGTCAGCCAGAGAGCTCTGG + Intronic
1088560059 11:111105620-111105642 TGATCCAAGCCTGAGACCTCAGG + Intergenic
1089922261 11:122220525-122220547 TGAAACTTGCCAGAGATTTCTGG - Intergenic
1090157392 11:124455273-124455295 TGAAGGGATCCAGAGATCTCTGG + Intergenic
1091140187 11:133228004-133228026 TCAACCCAGCCCCAGCTCTCAGG - Intronic
1097517246 12:60620500-60620522 AGATGCCAGCCAGAGCTCTCCGG - Intergenic
1097594327 12:61609769-61609791 TCAGCCCAGCCAGAGATTCCAGG + Intergenic
1098916011 12:76257617-76257639 TGGACCCAGGCTGAGATCCCAGG + Intergenic
1099534483 12:83827633-83827655 TTAACACAGCCAGTGATCACAGG - Intergenic
1101660095 12:106758091-106758113 TTATTCCAGACAGAGATCTCTGG + Intronic
1103284034 12:119785317-119785339 TGTACCCATCCAGATATCCCAGG - Intronic
1103745479 12:123120211-123120233 TGAACCCAGTCCGTGAACTCAGG - Intronic
1104762386 12:131305272-131305294 TGCACACACCCGGAGATCTCAGG + Intergenic
1105575605 13:21648659-21648681 TGAACCCAGTTAGAGTGCTCAGG - Intergenic
1105645725 13:22315845-22315867 AGATGCCAGCCAGAGCTCTCTGG + Intergenic
1107556194 13:41518490-41518512 GGAACTAATCCAGAGATCTCAGG - Intergenic
1111636228 13:90907641-90907663 AGAATCCAGCCAGAGATGGCTGG - Intergenic
1115355149 14:32439164-32439186 TGTACCCAGACTGAGATGTCTGG + Intronic
1116059999 14:39910995-39911017 TCATCCCAGCCAGAATTCTCTGG + Intergenic
1116177254 14:41488009-41488031 TGAACCAATCCAGAAATCACAGG + Intergenic
1118080756 14:62357526-62357548 TTAACTCAGCCAGAGATTTTAGG + Intergenic
1118745736 14:68771747-68771769 CGAACCCAGGGAGAGGTCTCGGG + Intergenic
1119207948 14:72808774-72808796 GGAAACCAGCCAAAGGTCTCCGG + Intronic
1122584235 14:102793552-102793574 TCATCCCAGCCAGAGATGTTAGG - Intronic
1125233730 15:37486480-37486502 TGAACACAGACAGGGAGCTCAGG - Intergenic
1127009498 15:54607260-54607282 AGAACCAAGCCACAGATCACAGG + Intronic
1136140935 16:28288247-28288269 TGATCCCAGCCAAAGAACTAAGG - Intergenic
1143438168 17:6945878-6945900 TGAATCTTGGCAGAGATCTCTGG - Intronic
1146253933 17:31377929-31377951 TGAAGCCAGTCAGAAATGTCAGG + Intronic
1146832568 17:36082448-36082470 TGACCCCAGCCAGAGAGTGCAGG + Intergenic
1146847048 17:36188760-36188782 TGACCCCAGCCAGAGAGTGCAGG + Intronic
1147654011 17:42078221-42078243 TCAGCCCAGCCAGGGATCCCTGG - Intergenic
1156925555 18:42573726-42573748 TGAACCCATCCACAAATCTGGGG - Intergenic
1158494313 18:57940391-57940413 GGAACTCAGCCAGAGACCTGGGG - Intergenic
1162451976 19:10760558-10760580 TAAAACCAGCCAGATATCTGGGG - Intronic
1167490607 19:49790844-49790866 TGAATCCACCCAGAGACCTGTGG + Intronic
926727914 2:16012981-16013003 TGCCCCCAGCCAGTGGTCTCAGG - Intergenic
928009897 2:27597501-27597523 TTAACCTGGCCAGAGATTTCTGG - Intronic
933116678 2:78481904-78481926 TGAACCCTGGCATAGATCTCTGG + Intergenic
936088469 2:109485968-109485990 TGGAGCCAGCCAGACAGCTCAGG + Intronic
938224599 2:129605087-129605109 GTAACCCAGCCTGAGAGCTCAGG + Intergenic
938950520 2:136250449-136250471 GGAACCCAGCAGGAGATCTGAGG + Intergenic
939476386 2:142693519-142693541 AGAAATCAGCCAGAGAACTCAGG + Intergenic
944093909 2:195945361-195945383 TGATCCCACCCAGTGAACTCTGG - Intronic
944384617 2:199150720-199150742 AGAACCCACTCAGACATCTCTGG + Intergenic
944844810 2:203657858-203657880 TGAACCCAGCCTGGGGTGTCAGG - Intergenic
945332185 2:208552586-208552608 TCAACCCAACCAGAGATCCTGGG + Intronic
946806530 2:223476185-223476207 TGTCCCCAGCCAGACCTCTCTGG - Intergenic
947397685 2:229702596-229702618 TGAAACCATCCACAGATCCCAGG + Intronic
948904636 2:240972908-240972930 CAAACCCAGGCAGAGAGCTCAGG + Intronic
948959548 2:241322312-241322334 TGTGCCCAGCCAGAGATATGTGG - Intronic
1173156524 20:40617096-40617118 TGAACCCATTCAGTTATCTCTGG + Intergenic
1174026105 20:47576999-47577021 TCAACTCAGCCAAAGATATCAGG + Intronic
1177476258 21:21627767-21627789 GAAACCCAGCCAGTCATCTCAGG - Intergenic
1177490869 21:21824406-21824428 TGAACCTAGACAGAGAACACAGG + Intergenic
1177844528 21:26273071-26273093 TCAGCCCAGCCAGAGATTCCTGG - Intergenic
1179136562 21:38684858-38684880 AGAACACAGCCAGAGAGCCCTGG - Intergenic
1179183044 21:39061682-39061704 TGAACCCAGCCAGTGAGCTAAGG - Intergenic
1179304934 21:40145171-40145193 TGCACCCAGCAAGAACTCTCGGG + Intronic
1179515248 21:41901937-41901959 TGAAACCAGCTAGAGACCACAGG + Intronic
1181599647 22:23941941-23941963 TCATATCAGCCAGAGATCTCTGG - Intergenic
1181608860 22:23999365-23999387 TCATATCAGCCAGAGATCTCTGG + Intergenic
1183404681 22:37624665-37624687 TGAAGCCATGCAGAGATCTGGGG + Intronic
1184262598 22:43327996-43328018 TTCACCCAGGCAGAGATCCCTGG - Intronic
949356882 3:3190490-3190512 TGAACCCATCTAGATATTTCAGG - Intergenic
950738230 3:15028588-15028610 TGAAACAAGCCAGGGAGCTCTGG + Exonic
955912242 3:63869225-63869247 TGAACACAACCAGAGAGCTCAGG - Intronic
959092994 3:101924440-101924462 AGATGCCAGCCAGAGCTCTCCGG + Intergenic
959545065 3:107586223-107586245 TGCACTCAGCCACAGTTCTCTGG - Intronic
959566146 3:107834775-107834797 TGAACCCACCGTGGGATCTCAGG + Intergenic
960378554 3:116932452-116932474 GGAACCCAGACACAGATCTGGGG + Intronic
960922432 3:122761056-122761078 TGCACCCAGCCAGGGAGCTTAGG + Intronic
964669458 3:159209292-159209314 GGAACCCAGCCAGAGATGGCTGG + Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967103112 3:186233179-186233201 TGAACCCACCCAGAAAATTCAGG - Intronic
968513456 4:1005242-1005264 TGCACTCAGCCAGAGAGCTGGGG + Intergenic
969376675 4:6767898-6767920 TGAGCCCATCCAGACCTCTCAGG - Intergenic
971240875 4:24887698-24887720 TGGTCCCTGCCAGAGATCACAGG - Intronic
971735306 4:30441664-30441686 TGTACCCAGCAAGTGATTTCTGG - Intergenic
973615755 4:52676250-52676272 ACAACCCAGCCAGAGAGATCGGG + Intergenic
977781488 4:100986255-100986277 AGAATCCAGCCAGAGATGGCTGG + Intergenic
978847081 4:113286359-113286381 TGAGCTCACCCAGAGCTCTCAGG + Intronic
979620771 4:122796589-122796611 TGAGCCCAGCCAGGGATTTGAGG - Intergenic
982761835 4:159294016-159294038 TGCACCCAGCAAGAGAGCACTGG + Intronic
988317453 5:29648598-29648620 TGCACCCAACCAAGGATCTCAGG + Intergenic
989387459 5:40867688-40867710 GGAGCCCAGCCAGAGATGGCTGG - Intergenic
990726967 5:58766678-58766700 TGAACCCCACCAGCGACCTCTGG - Intronic
993507488 5:88728584-88728606 TAAACCCAGACAGAGATGACAGG + Exonic
994005656 5:94834664-94834686 CGATTCCAGTCAGAGATCTCAGG + Intronic
997295072 5:132764017-132764039 TGTATCCAGTCAGGGATCTCAGG - Intronic
998050410 5:139028033-139028055 TGCACCCAGCTAGAGGTCTCTGG + Intronic
999045737 5:148467728-148467750 TGCAAACAGCCAGAGGTCTCAGG - Intronic
1005810065 6:29508590-29508612 AGAAACCAGCCTGAGCTCTCTGG + Intergenic
1006884992 6:37374041-37374063 TGAACCCTGCCAGTGTTTTCTGG - Intronic
1007690641 6:43699084-43699106 TGGACCCCGACAGAGATCTGGGG - Intergenic
1008075153 6:47138248-47138270 TGAGCCCAGCCAGACGTCACTGG + Intergenic
1008417557 6:51260460-51260482 TGAAACCAGCCAGAAATGTGAGG + Intergenic
1009452180 6:63814325-63814347 TGAACCAAGACAGAGATACCCGG + Intronic
1012373748 6:98536955-98536977 TGCACCCAGCCAGAGTGCTCAGG - Intergenic
1014625454 6:123719398-123719420 AGAACCCAGCCGGAGATGGCTGG + Intergenic
1014706348 6:124752008-124752030 TGAAACCAGATTGAGATCTCTGG - Intronic
1020852562 7:13376100-13376122 TGATCCCAGCCAGAGATTCTAGG + Intergenic
1024199054 7:47088230-47088252 TGAGCCCAGCCACACAGCTCAGG + Intergenic
1025780895 7:64600897-64600919 TGAACCCAGCGATACATCCCAGG - Intergenic
1026827814 7:73595253-73595275 TGAGCCCAGGCAGGGAGCTCAGG - Intronic
1026906649 7:74066627-74066649 TGATCCCAGACAGAGGTCTTGGG + Intronic
1030347033 7:108446037-108446059 TGCAGCCACCCAGAGACCTCCGG + Intronic
1032741343 7:134742552-134742574 TGAACCACACCAGAGATCCCAGG - Intergenic
1032841240 7:135714924-135714946 TGGGCCCAGCCAGCGGTCTCTGG - Intronic
1032849958 7:135785681-135785703 AGAACCCAGTGAGAGATGTCAGG + Intergenic
1037525961 8:19724512-19724534 TGAACCCACCCAGATAACCCAGG + Intronic
1037727434 8:21494629-21494651 GAAGCCCAGACAGAGATCTCTGG - Intergenic
1039458538 8:37724757-37724779 TGTGCCCAGCCAGAGATATTTGG - Intergenic
1039815654 8:41092461-41092483 TGCACCCAGCCTGGGAACTCGGG - Intergenic
1042838359 8:73098139-73098161 TGAAGCCAGCCTGAGATCTTAGG + Intronic
1042929848 8:74002448-74002470 TGAACTCAGAGAGAGATCACTGG - Intronic
1044914940 8:97103115-97103137 TGGACCCACCCAGATAACTCAGG + Intronic
1045340264 8:101247936-101247958 TGAAACCAGCCAGTGTTCTTAGG + Intergenic
1045433926 8:102140423-102140445 TGTATCCAGGGAGAGATCTCTGG - Intergenic
1046843327 8:118885763-118885785 TCATCCCAGCCAGAGATTTGGGG - Intergenic
1049390203 8:142363786-142363808 TCAACCGACCCAGAGATCTCAGG + Intronic
1049619922 8:143593480-143593502 GGATCCCAGCCAGGGCTCTCGGG - Intronic
1051230548 9:14950474-14950496 AGACGCCAGCCAGAGCTCTCCGG - Intergenic
1051361423 9:16285004-16285026 TGTACCCTTCCAGAGCTCTCTGG - Intergenic
1052975247 9:34405420-34405442 TCAGCCCATCTAGAGATCTCTGG - Intronic
1057028267 9:91753582-91753604 GAAACCCAGCCACAGGTCTCAGG + Intronic
1057268013 9:93631607-93631629 TGAGCCCACCCAGAAAGCTCAGG + Intronic
1058153816 9:101489678-101489700 TGAACCCAACCAGAAATCAGAGG + Intronic
1060637338 9:125209712-125209734 TGAACACAGCTTGAGCTCTCTGG + Intronic
1061084885 9:128393015-128393037 TGCCCCCAGCCTGGGATCTCCGG + Intergenic
1187242935 X:17530177-17530199 TGAACGTGTCCAGAGATCTCTGG + Intronic
1188111912 X:26204473-26204495 GGAAGTCAGCCAGAGATTTCTGG - Intergenic
1190343193 X:49313591-49313613 TTAACCCAGACAGAGTCCTCTGG - Intronic
1190875692 X:54458702-54458724 CTAACCCAGCCCGAGAACTCTGG - Intronic
1191591401 X:62888837-62888859 TGATGCCAGCCAGAGCTCTCCGG - Intergenic
1192269238 X:69563304-69563326 TGAAGCCAGCCAGACAGCCCTGG + Intergenic
1194850755 X:98865598-98865620 TGAGTCGAGCCAGAGATCACTGG - Intergenic
1195903829 X:109825049-109825071 TGGACCCAGCCAAAGGTGTCTGG + Intergenic
1199690619 X:150306501-150306523 TGAAGCCAGCGAGACATCTAAGG + Intergenic
1200968120 Y:9120107-9120129 TGAATCCAGCCAGTAATCTCAGG - Intergenic
1202063067 Y:20908579-20908601 TCAACCAAAACAGAGATCTCGGG + Intergenic
1202087008 Y:21148923-21148945 TGTAACCAGCCAGTGATTTCTGG + Intergenic
1202125746 Y:21567575-21567597 TGAACCTTGCAAGAGCTCTCTGG - Intergenic
1202142622 Y:21743967-21743989 TGAATCCAGCCAGTAATCTCAGG + Intergenic
1202144236 Y:21761651-21761673 TGAATCCAGCCAGTAATCTCAGG - Intergenic
1202153258 Y:21861804-21861826 TGAACCTTGCAAGAGCTCTCTGG + Intergenic