ID: 1080763119

View in Genome Browser
Species Human (GRCh38)
Location 11:35271757-35271779
Sequence CGCTTGGGCCTGAGAGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2729
Summary {0: 1, 1: 0, 2: 11, 3: 177, 4: 2540}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080763110_1080763119 17 Left 1080763110 11:35271717-35271739 CCTGTAATCCCAGCTGCTCTGGA 0: 163
1: 7257
2: 117664
3: 258986
4: 245143
Right 1080763119 11:35271757-35271779 CGCTTGGGCCTGAGAGACGAAGG 0: 1
1: 0
2: 11
3: 177
4: 2540
1080763112_1080763119 9 Left 1080763112 11:35271725-35271747 CCCAGCTGCTCTGGAGGCTGAGG 0: 350
1: 15254
2: 223441
3: 278622
4: 178387
Right 1080763119 11:35271757-35271779 CGCTTGGGCCTGAGAGACGAAGG 0: 1
1: 0
2: 11
3: 177
4: 2540
1080763114_1080763119 8 Left 1080763114 11:35271726-35271748 CCAGCTGCTCTGGAGGCTGAGGT 0: 64
1: 2533
2: 37188
3: 249789
4: 280339
Right 1080763119 11:35271757-35271779 CGCTTGGGCCTGAGAGACGAAGG 0: 1
1: 0
2: 11
3: 177
4: 2540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080763119 Original CRISPR CGCTTGGGCCTGAGAGACGA AGG Intronic
Too many off-targets to display for this crispr