ID: 1080764240

View in Genome Browser
Species Human (GRCh38)
Location 11:35280892-35280914
Sequence GGCTGATGTCCTCTGTTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080764231_1080764240 21 Left 1080764231 11:35280848-35280870 CCCATCCACAGACACTTACAGCA 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1080764235_1080764240 -3 Left 1080764235 11:35280872-35280894 CCAGTCCACAGCCACCAGCAGGC 0: 1
1: 0
2: 3
3: 39
4: 377
Right 1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1080764232_1080764240 20 Left 1080764232 11:35280849-35280871 CCATCCACAGACACTTACAGCAG 0: 1
1: 0
2: 0
3: 25
4: 233
Right 1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1080764236_1080764240 -8 Left 1080764236 11:35280877-35280899 CCACAGCCACCAGCAGGCTGATG 0: 1
1: 0
2: 3
3: 42
4: 365
Right 1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1080764230_1080764240 22 Left 1080764230 11:35280847-35280869 CCCCATCCACAGACACTTACAGC 0: 1
1: 0
2: 1
3: 21
4: 265
Right 1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1080764233_1080764240 16 Left 1080764233 11:35280853-35280875 CCACAGACACTTACAGCAGCCAG 0: 1
1: 0
2: 0
3: 11
4: 224
Right 1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080764240 Original CRISPR GGCTGATGTCCTCTGTTGGC AGG Exonic
905009410 1:34737046-34737068 TGCTGGTGGCCTCTGTTGGGGGG - Intronic
907961154 1:59283210-59283232 GGCTCATGACCTCTGAGGGCTGG - Intergenic
911359935 1:96863379-96863401 GGATGATGTCCCATGATGGCTGG + Intergenic
914899567 1:151704559-151704581 GGCTGATGTCCTCACTTCTCAGG + Intronic
915339292 1:155167505-155167527 GCATGATGCCCTCTGGTGGCCGG + Intergenic
919940436 1:202282406-202282428 GCCTGCTGTCCTCTTTTGTCTGG + Intronic
920367841 1:205457364-205457386 GGCTGGTGTCCCCTGATGTCTGG - Intergenic
923076398 1:230612766-230612788 GGCTGAAGTCATCTGAAGGCTGG + Intergenic
924095312 1:240545059-240545081 TGCTGATGTTGTCTGATGGCTGG + Intronic
924159112 1:241211524-241211546 TGGTGATGTCCTCTTTTGTCAGG - Intronic
1069331654 10:67300379-67300401 GGTTGCTGTCCTCTGTAGGAAGG - Intronic
1073419089 10:103409462-103409484 GATTGATGTCCTCTCTTAGCTGG + Intronic
1078003624 11:7516533-7516555 GCCTCATGTTGTCTGTTGGCAGG - Intronic
1078095593 11:8294661-8294683 AGCTGATGTCCTCTCTTCCCTGG - Intergenic
1078322449 11:10348798-10348820 TGTTGATGTCTGCTGTTGGCAGG - Intronic
1079429925 11:20379681-20379703 GCCTCATGTCCTCTGTTCTCAGG + Intronic
1079733292 11:23962492-23962514 GGTAGATCCCCTCTGTTGGCAGG - Intergenic
1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG + Exonic
1081758959 11:45563681-45563703 GGCTGATCTCCCCTGATGGACGG + Intergenic
1082770396 11:57203340-57203362 GGTTGATGTCCTCTGGTTTCTGG - Intergenic
1083691493 11:64411558-64411580 TCCTGCTGTCCTCTGTTGGGAGG + Intergenic
1084177860 11:67432890-67432912 GGCTGAGGACCTCTGTGGGTGGG + Intronic
1085067296 11:73508762-73508784 GTCTTATGTCCTCTGCTGCCAGG - Intronic
1086030486 11:82349346-82349368 AGCAGGTGTCCTATGTTGGCAGG - Intergenic
1089631891 11:119789165-119789187 GGCTGAACTCCTCTGTAAGCGGG - Intergenic
1090946065 11:131430761-131430783 GCCTGTTTTCCTCTGTTGGAGGG + Intronic
1091131393 11:133149996-133150018 GGCTGGAGCCCTCTGTAGGCAGG - Intronic
1096585219 12:52615553-52615575 GTCTGATTTCCTCTGATGCCTGG + Intronic
1097160005 12:57039354-57039376 TTCTGATGTCCTTTGTTGGGTGG - Intronic
1097694606 12:62764269-62764291 GGCTTATGTCCTATATTGCCAGG + Intronic
1099171580 12:79370914-79370936 GGCTGATGTTGTCTTTAGGCTGG - Intronic
1099359804 12:81686209-81686231 GGCTGATATCCTCTGATGGGAGG + Intronic
1104301047 12:127565301-127565323 GGTTGATTTCATCTGTGGGCTGG + Intergenic
1107841610 13:44463939-44463961 AGCTGATGCTGTCTGTTGGCAGG - Intronic
1109439415 13:62349782-62349804 GGCTGGAGACCTCTGTTGGGAGG - Intergenic
1110145079 13:72180660-72180682 GGTCGATGACCTCTGCTGGCAGG + Intergenic
1112294361 13:98173718-98173740 GGCTGATGTGTTCTTTTGACCGG + Intronic
1112677753 13:101723130-101723152 GAGTAATGTCCTCTGTGGGCTGG - Intronic
1112975567 13:105313645-105313667 GCCTGATGACTGCTGTTGGCTGG + Intergenic
1114633307 14:24173115-24173137 GCTGGATGTCCTCTGTGGGCAGG - Exonic
1117440630 14:55755942-55755964 GGCTGCAGTCATCTGTAGGCTGG + Intergenic
1117932123 14:60854729-60854751 GTCTGTTGACCTCTGTTGGGAGG + Intronic
1118884282 14:69853562-69853584 GTCTGATTTCCTCTGGAGGCAGG + Intergenic
1121218433 14:92266349-92266371 GGCTGATGTCCTCCATTTGATGG + Intergenic
1123053516 14:105559084-105559106 GGCTGCTGTCCTCTGTGCTCAGG + Intergenic
1123078093 14:105679498-105679520 GGCTGCTGTCCTCTGTGCTCAGG + Intergenic
1124134865 15:27025921-27025943 GGCTGATGTCCTCTGAAAGGAGG - Intronic
1131592219 15:93762181-93762203 GGCTGCTTTCTTCTGTTGCCTGG - Intergenic
1131650871 15:94398129-94398151 CTCTGCTGTCCTCTCTTGGCTGG - Intronic
1133415205 16:5601238-5601260 GGCTGCTGTCTTCTGAAGGCTGG + Intergenic
1138183350 16:54958143-54958165 GGCTGATGACCTCTTTTCTCTGG + Intergenic
1138507139 16:57484031-57484053 GGCTGGTGTCCTGGGGTGGCGGG + Intronic
1141384301 16:83605357-83605379 GGCTGATGTTCTTTGTTGAAGGG + Intronic
1141428133 16:83956813-83956835 GGCTGGTGTCCGCTGCTAGCTGG + Intronic
1142088739 16:88198965-88198987 GCCTCATGTTCTCTGTTAGCTGG + Intergenic
1144063335 17:11602537-11602559 GGATGATGTCCTTTGATGACAGG - Intronic
1144228371 17:13174026-13174048 GGATGATGGCCTCTTTTGCCGGG + Intergenic
1146680360 17:34802955-34802977 GGTGGCTGTCCTCTGTAGGCTGG - Intergenic
1147842438 17:43381488-43381510 GGCTGCTCTCCTCAGCTGGCAGG - Intergenic
1149183824 17:53973705-53973727 GGCTGATGTCTGCATTTGGCTGG - Intergenic
1149418948 17:56489789-56489811 GACAGATGTCCTCTCTTGGCTGG - Intronic
1157522695 18:48356307-48356329 GGCTGCTCTGCGCTGTTGGCTGG - Intronic
1158155786 18:54424079-54424101 GGCTGATGGCCTCTCTCTGCTGG - Intergenic
1160243865 18:77141868-77141890 CTCTGTTGCCCTCTGTTGGCTGG - Intergenic
1160355141 18:78221381-78221403 GGCTGATGTCCACTGTGGGAAGG - Intergenic
1160396678 18:78577264-78577286 AGCTGATGTCCTCTGTGTTCGGG - Intergenic
1160685611 19:435146-435168 GGCTCATGCCCTCTGCTGCCGGG - Intronic
1160701272 19:508550-508572 GGCTGATGTCTTTTGTTGGGGGG + Intronic
1162350913 19:10148888-10148910 ACTTGTTGTCCTCTGTTGGCTGG + Exonic
1162477317 19:10908285-10908307 GGCAGGTTTCCTCTGCTGGCTGG + Intronic
1165551970 19:36594539-36594561 GGTTGATGTTGGCTGTTGGCTGG - Intronic
1167922507 19:52793484-52793506 GGCTGCTTTCCTTTGTTGGGAGG - Intronic
928062991 2:28133806-28133828 GACTGATGTTCTCTTTTGTCAGG - Intronic
928757505 2:34545104-34545126 GTCTGATGACCTCTGTTGTAGGG + Intergenic
930455677 2:51605337-51605359 GTCTGGTGACCTCTGTTGGGAGG + Intergenic
933194427 2:79372173-79372195 GACTGATGGCATCTGGTGGCAGG + Intronic
934624526 2:95835526-95835548 GGCTGAAGTCCCCGGTTGGGAGG - Intergenic
934729029 2:96644780-96644802 TGCTGATGTCCTCAGTCTGCAGG + Intergenic
941088470 2:161146765-161146787 GTCTGATGACCCCTGTTGGAGGG + Intronic
941992134 2:171567796-171567818 GGCTGATGTTGGCTGTTAGCTGG - Intergenic
944392135 2:199228635-199228657 GGCTGATGTGCTCTGCTTGCGGG - Intergenic
944636547 2:201680902-201680924 GAATGATGCCCTCTGGTGGCAGG - Exonic
945522623 2:210847264-210847286 GGCTGATGTCCTCTGGAGATTGG + Intergenic
946702494 2:222426600-222426622 AGCAGAAGTCCTGTGTTGGCTGG - Intronic
948564830 2:238878138-238878160 GGCTGATGTTCTCTGTTAGTTGG + Intronic
1170485809 20:16815330-16815352 TGCTGAAGTCCTCAGTTGACTGG - Intergenic
1171178105 20:23070119-23070141 TGCTGATGCCCTCTCTGGGCTGG - Intergenic
1174278318 20:49419818-49419840 GGCTGTTGTCCTCAGTATGCTGG - Intronic
1174823907 20:53751510-53751532 GGCTCACTTCCTCTCTTGGCTGG - Intergenic
1178476289 21:32940132-32940154 TGCTGCTGGCCTCTGTTGGGTGG + Intergenic
1178589706 21:33899019-33899041 AGCTCATCTCCTCTGCTGGCAGG - Exonic
1179088079 21:38238101-38238123 GGCTGAAGTCACCTGGTGGCAGG + Intronic
1180739837 22:18045383-18045405 GGCTGATGGCCTCTGCTAGGAGG + Intergenic
1182549265 22:31092222-31092244 GGCTGATGTCCAGTGTGGGTGGG - Intronic
1184617634 22:45648713-45648735 GGATGATGTCCCCTGTGGTCCGG - Intergenic
950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG + Intronic
953708526 3:45249530-45249552 GGCTGATGTCCAATATTAGCTGG + Intergenic
955277196 3:57557408-57557430 CGCCGATGTCATCTGTTTGCAGG + Exonic
960562374 3:119098842-119098864 AGGTGATGTCCTCAATTGGCTGG + Intronic
961777780 3:129302037-129302059 AGGTGATGTTCTCTGTTGGGTGG - Exonic
962481223 3:135800355-135800377 GGCTGATGTGCCCTAGTGGCAGG - Intergenic
963531458 3:146477063-146477085 GTCTGGTGACCTCTGTTTGCGGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
969281168 4:6171501-6171523 GGCTGATGTTCTTTGATGGCTGG - Intronic
975250370 4:72171691-72171713 GGCTGATGACCTATTTTGACAGG - Intergenic
986708452 5:10470565-10470587 GGTTGATGTCCACTGTTTCCTGG + Intronic
987837339 5:23178772-23178794 GTCTGGTGACCTCTGTTGGGAGG + Intergenic
989531871 5:42516813-42516835 GCCTCATGTCCTCTGTGGTCAGG + Intronic
994537047 5:101045194-101045216 GGCTAATGACCACTGTTGGCAGG + Intergenic
995491087 5:112692210-112692232 TGCTGAGGTCCTCTGCTGGTGGG - Intergenic
995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG + Intergenic
999320954 5:150614781-150614803 GGCGGATCTCCTCTGTGGGTAGG - Intronic
1000197300 5:158972128-158972150 GGCTGATGACCTTTGTGGGAAGG + Intronic
1002074048 5:176697644-176697666 GGCTGATGGCCTCTCTCGGGGGG + Intergenic
1002446829 5:179295217-179295239 GGCTGATGTTCTGGGCTGGCGGG + Intronic
1003075306 6:2978861-2978883 AACTTATGTCCTCTGTTGGAGGG - Intergenic
1005255521 6:23998716-23998738 CGCTGATGCCCTCTGTGGCCTGG - Intergenic
1005836222 6:29711427-29711449 GGGTGGTGTCCTCTGCAGGCTGG + Intergenic
1005862805 6:29914304-29914326 GGGTGTTGTCCTCTGCAGGCTGG + Intergenic
1008056134 6:46947848-46947870 GGTTGTTGGCCTCTGCTGGCAGG - Intronic
1008913194 6:56758659-56758681 GGCTGATGTTAACTATTGGCTGG + Intronic
1009963502 6:70553155-70553177 GGCTGGTCTCCTCTGCTGGGGGG - Intronic
1011654989 6:89544004-89544026 TGGTTTTGTCCTCTGTTGGCTGG - Intronic
1012572094 6:100742304-100742326 GGCTGAAGACCTCTGTTGGGAGG + Intronic
1017662090 6:156684827-156684849 AGTTGATGTTATCTGTTGGCTGG + Intergenic
1018178875 6:161202925-161202947 GGTTGATGTTGGCTGTTGGCTGG - Intronic
1018986469 6:168641242-168641264 GGCTGATGTCCTCTGCCATCCGG - Intronic
1019224620 6:170499980-170500002 GGCTGAGGGCCTGTGTTAGCCGG - Intergenic
1019347378 7:537727-537749 GGCCGATGTCTTTTTTTGGCGGG - Intergenic
1023119651 7:36896456-36896478 GACTGATGGACTCTGTTGGCAGG + Intronic
1023995594 7:45157527-45157549 GGCTGATGGGCTCTGAGGGCGGG - Intergenic
1026646133 7:72170577-72170599 GCCTGATGTTCTCTGTTCTCTGG - Intronic
1036536068 8:9653898-9653920 GGCTGAAGTCATCTGGTAGCAGG - Intronic
1037421711 8:18709548-18709570 GTCTGATGACTTCTGTTGGGAGG - Intronic
1040546091 8:48398997-48399019 GGCTGGAGTCCTCTGGAGGCAGG + Intergenic
1040978385 8:53219305-53219327 AGTTGATGTCCTCTGTTGGCTGG + Intergenic
1054936491 9:70694217-70694239 GGCAGATGTCCTGTGTTGAAAGG + Intronic
1055827942 9:80349188-80349210 GGCTGAACTCCACAGTTGGCAGG - Intergenic
1056838399 9:89976947-89976969 GTCTGGTGTCCTCAGCTGGCAGG + Intergenic
1057423249 9:94928594-94928616 AGCAGATGTCATCAGTTGGCAGG - Intronic
1061583835 9:131554279-131554301 GGCAGATGGCCTCTATTGGGAGG - Intergenic
1062497119 9:136837202-136837224 GGATGATGGCCTCTGTGGGGCGG + Intronic
1186774776 X:12854180-12854202 GTCTGTTGACCTCTGTTGGGAGG + Intergenic
1187932104 X:24302926-24302948 AGCTGCTGGCCTCTGTTGGGAGG + Intergenic
1191043723 X:56113806-56113828 GTCTGGTGACCTCTGTTGGGAGG + Intergenic
1191684174 X:63871699-63871721 GGCTGCCTTCCTCTGTTGGATGG - Intergenic
1198784404 X:140272313-140272335 GTCTGATGACCCCTGTTGGGAGG + Intergenic
1200150974 X:153951312-153951334 TGCTGATGTCCTCAGGTGGGTGG - Intronic
1200902162 Y:8443778-8443800 GGATAATTTCCCCTGTTGGCAGG + Intergenic