ID: 1080766133

View in Genome Browser
Species Human (GRCh38)
Location 11:35298814-35298836
Sequence GATTTCCACTAAACCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080766133_1080766138 25 Left 1080766133 11:35298814-35298836 CCTGCAAGGGTTTAGTGGAAATC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1080766138 11:35298862-35298884 ACATACATTGCCCATGTTATTGG 0: 1
1: 0
2: 1
3: 6
4: 111
1080766133_1080766136 -4 Left 1080766133 11:35298814-35298836 CCTGCAAGGGTTTAGTGGAAATC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1080766136 11:35298833-35298855 AATCACATTGGTATGGACATAGG 0: 1
1: 0
2: 2
3: 13
4: 193
1080766133_1080766137 0 Left 1080766133 11:35298814-35298836 CCTGCAAGGGTTTAGTGGAAATC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1080766137 11:35298837-35298859 ACATTGGTATGGACATAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080766133 Original CRISPR GATTTCCACTAAACCCTTGC AGG (reversed) Intronic
904516804 1:31062147-31062169 TCTTTCTACTAACCCCTTGCAGG + Intronic
914394349 1:147250674-147250696 GCTTTCCACTTAGCCTTTGCTGG + Intronic
915524745 1:156468674-156468696 GATGTCCACTAGAACCCTGCAGG + Intronic
916470875 1:165120959-165120981 GATTTCCACTAAACATATTCTGG - Intergenic
921386368 1:214574044-214574066 CATTTCGACTATACGCTTGCTGG + Intergenic
923031380 1:230251695-230251717 GATTTCCACTAAACCATTAGGGG - Intronic
924747646 1:246851996-246852018 TTCTTCCACCAAACCCTTGCAGG - Intronic
1063163555 10:3438951-3438973 AATTTCCAGAAAACCCTTGCTGG - Intergenic
1063904547 10:10768319-10768341 CATTACCACTAATCCCATGCAGG - Intergenic
1067271870 10:44798702-44798724 GCTTTCCACTCAGCCTTTGCTGG - Intergenic
1080592515 11:33736256-33736278 GCTTTCCACTCGACCCCTGCCGG - Intronic
1080766133 11:35298814-35298836 GATTTCCACTAAACCCTTGCAGG - Intronic
1081556745 11:44170900-44170922 GAATTCCTCTAAAACCTTTCAGG + Intronic
1086221317 11:84447063-84447085 GATTTCCCCAAATCTCTTGCAGG - Intronic
1087842689 11:102936233-102936255 GGTTTCTACTAAACCCATGTTGG + Intergenic
1089573565 11:119425349-119425371 GGATTCCTCTAAAGCCTTGCTGG - Intergenic
1098059346 12:66543622-66543644 CAATCCCTCTAAACCCTTGCTGG + Intronic
1100027076 12:90143569-90143591 ATTTTCCCCTAAAACCTTGCTGG - Intergenic
1102639984 12:114358583-114358605 TATTTCCACTAGACTCTTTCTGG + Intronic
1106423279 13:29601876-29601898 TTTTACCACTAAATCCTTGCAGG - Intergenic
1107776529 13:43849739-43849761 GCTTTCCACCCAGCCCTTGCTGG - Intronic
1109916808 13:68999769-68999791 TATTTCCACCATATCCTTGCTGG + Intergenic
1112161602 13:96874138-96874160 GATTTCCACCATTCCCTTGCTGG - Intergenic
1112416738 13:99209147-99209169 GAGATCCACTGTACCCTTGCTGG + Intronic
1112933351 13:104769193-104769215 CATTTCCACTGATCCCTTGTTGG + Intergenic
1114051307 14:18921252-18921274 GATTCCCACTAATCCCTGCCCGG - Intergenic
1114111255 14:19480673-19480695 GATTCCCACTAATCCCTGCCCGG + Intergenic
1114621141 14:24096949-24096971 GATCTCCACTAAGCACTCGCAGG - Exonic
1116117461 14:40673698-40673720 AATTTCAAATAAAGCCTTGCAGG - Intergenic
1119626720 14:76183731-76183753 CATCTTCACTAACCCCTTGCTGG - Intronic
1123827345 15:24095519-24095541 TAATTCCACTAAAGCCTTTCTGG + Intergenic
1123851885 15:24366020-24366042 TAATTCCACTAAAGCCTTTCTGG + Intergenic
1123856817 15:24420949-24420971 TAATTCCACTAAAGCCTTTCGGG + Intergenic
1128734695 15:70046646-70046668 GCTTTCCACCCAACCCTGGCTGG - Intergenic
1129557076 15:76522032-76522054 AATTTACACTAAATTCTTGCGGG - Intronic
1137453564 16:48599782-48599804 GTTTTCCAGAAAACCCTAGCAGG - Intronic
1139231967 16:65292057-65292079 GATTTCCACTAAGTACTTTCTGG + Intergenic
1143342973 17:6227964-6227986 TATGTCCACTAAAACCTTGCTGG - Intergenic
1151958429 17:77392414-77392436 CATTTCCACTAACCCCTGGATGG - Intronic
1158731440 18:60027859-60027881 GATTTCCCCAAAACACCTGCTGG + Intergenic
1164730384 19:30499822-30499844 GACTTCCACCAAGCCCTTGCTGG - Intronic
927652138 2:24919579-24919601 TTTTTCCACCAAACCCTTGGAGG + Exonic
930044939 2:47162392-47162414 TGTTTCCACTAAACCATTTCAGG - Exonic
930681426 2:54260689-54260711 GATTCTGACTAATCCCTTGCAGG - Intronic
932696329 2:73959904-73959926 GATCTGCACTGAACCCTTGACGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
935146939 2:100402055-100402077 GACTTCCACCCAGCCCTTGCTGG - Intronic
939215226 2:139228349-139228371 GATTTCCAATAAGCACCTGCAGG + Intergenic
1170682158 20:18535899-18535921 GACTCCGACTAAACCCTTGAAGG - Intronic
1174926750 20:54768517-54768539 GATTTCCACTCAATACTTTCTGG - Intergenic
1176045505 20:63090744-63090766 CATTTCCACTGGACCCTTGCGGG + Intergenic
1180469780 22:15643627-15643649 GATTCCCACTAATCCCTGCCCGG - Intergenic
954365665 3:50144854-50144876 AATTTCCTCTAAACTCTGGCTGG + Intergenic
960470394 3:118057591-118057613 GATTTCCACAAAACCTTAGGTGG - Intergenic
964034377 3:152178183-152178205 GACTTCCATGAAACCCTTGAAGG - Intergenic
976486818 4:85615759-85615781 GATTTCCACTTATCCCTTGTGGG - Intronic
977184711 4:93922255-93922277 GTTTTCCTCAAAACCCTTTCAGG + Intergenic
982919578 4:161256062-161256084 CATTTTTACTAAACCTTTGCAGG - Intergenic
983521400 4:168712679-168712701 CATTTCCACTAACCTCTGGCAGG - Intronic
985798840 5:1987701-1987723 GATCTCCAGTGAACCCTTGAAGG - Intergenic
986131491 5:4936178-4936200 GAGTCCCACAAAACCCTTGAAGG - Intergenic
986565875 5:9113392-9113414 ATTTTCCTCTAAACCCTTACTGG - Intronic
1003307178 6:4940088-4940110 GATCTCCACTTAAACCTGGCTGG - Intronic
1008611981 6:53192692-53192714 GTTTCCTACTTAACCCTTGCTGG + Intergenic
1010605330 6:77882681-77882703 GGCTTCCACAAAACCCTTCCTGG - Intronic
1018319964 6:162597791-162597813 GACTTCCACTAAGTCCTTTCAGG + Intronic
1026845044 7:73693985-73694007 GATTTTCACTCAGCCCCTGCAGG - Exonic
1027420710 7:78015122-78015144 GAATTAAACCAAACCCTTGCTGG - Intergenic
1030518575 7:110567996-110568018 GATGTCCCCTATCCCCTTGCTGG + Intergenic
1032728091 7:134610768-134610790 AATTTCCACAACAACCTTGCAGG - Intergenic
1033078117 7:138268317-138268339 GACTCCCACTTAACCCCTGCTGG - Intergenic
1036968147 8:13323905-13323927 GATTTACACTAACTCCTTGCTGG - Intronic
1047091983 8:121584778-121584800 GATTTCCACAACATGCTTGCTGG - Intergenic
1047353970 8:124102721-124102743 GGTGTCCACTAAACCCCTCCAGG - Intronic
1053275679 9:36781555-36781577 GATTTCCACTAAATTCTCTCTGG + Intergenic
1056002334 9:82230566-82230588 GATAGCCCCTAAATCCTTGCGGG + Intergenic
1058894274 9:109386323-109386345 GACTCCCACTAAACCCTATCTGG - Intronic
1061154875 9:128852406-128852428 ACTTTCCACTAAAACCTGGCTGG - Intronic
1186301199 X:8201597-8201619 GATATCCACTAAATCCCTTCAGG + Intergenic
1193876569 X:86869120-86869142 GCTTTCCACTAACCCAGTGCAGG + Intergenic
1194807320 X:98345181-98345203 GAGAGCCACTCAACCCTTGCAGG - Intergenic
1195065974 X:101238678-101238700 GATTTCCATAAGACCCTTACAGG + Intronic