ID: 1080768363

View in Genome Browser
Species Human (GRCh38)
Location 11:35317494-35317516
Sequence TGCCAACAATATGCCCAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080768363_1080768366 14 Left 1080768363 11:35317494-35317516 CCTGCTTGGGCATATTGTTGGCA 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1080768366 11:35317531-35317553 AAGGCAGAGATTAGAGAGACTGG 0: 1
1: 0
2: 4
3: 57
4: 523
1080768363_1080768365 -5 Left 1080768363 11:35317494-35317516 CCTGCTTGGGCATATTGTTGGCA 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1080768365 11:35317512-35317534 TGGCACTGGAACAGAAGTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080768363 Original CRISPR TGCCAACAATATGCCCAAGC AGG (reversed) Exonic