ID: 1080768363 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:35317494-35317516 |
| Sequence | TGCCAACAATATGCCCAAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 98 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 87} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1080768363_1080768366 | 14 | Left | 1080768363 | 11:35317494-35317516 | CCTGCTTGGGCATATTGTTGGCA | 0: 1 1: 0 2: 0 3: 10 4: 87 |
||
| Right | 1080768366 | 11:35317531-35317553 | AAGGCAGAGATTAGAGAGACTGG | 0: 1 1: 0 2: 4 3: 57 4: 523 |
||||
| 1080768363_1080768365 | -5 | Left | 1080768363 | 11:35317494-35317516 | CCTGCTTGGGCATATTGTTGGCA | 0: 1 1: 0 2: 0 3: 10 4: 87 |
||
| Right | 1080768365 | 11:35317512-35317534 | TGGCACTGGAACAGAAGTGAAGG | 0: 1 1: 0 2: 0 3: 22 4: 209 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1080768363 | Original CRISPR | TGCCAACAATATGCCCAAGC AGG (reversed) | Exonic | ||