ID: 1080769180

View in Genome Browser
Species Human (GRCh38)
Location 11:35324820-35324842
Sequence CTGGAAATAAGCAAATTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080769180 Original CRISPR CTGGAAATAAGCAAATTTGT TGG (reversed) Intronic
900885426 1:5411900-5411922 CTCTAAACAACCAAATTTGTGGG - Intergenic
902316619 1:15624984-15625006 CTGAATATGAGCAAATTTGTAGG - Intronic
902643488 1:17781625-17781647 CTGGAAATAAGGATCTTTGTAGG - Intronic
904881871 1:33705804-33705826 ATGGAAATAAGAAAATGTTTAGG - Intronic
908374916 1:63526299-63526321 CTGGAAAGAACCAAATTTGGTGG - Intronic
908745412 1:67371651-67371673 ATGGAAATAAGGAATTTTGGTGG + Intronic
909839698 1:80304041-80304063 CTGCAAACAAGCAAATTAGAAGG - Intergenic
909946838 1:81673329-81673351 CTGAAAAGAAGGAATTTTGTTGG - Intronic
911531407 1:99047521-99047543 CTGAAAATAATCAGATTTATTGG - Intergenic
912135565 1:106656690-106656712 GTGGAAATAAGGAACTTTTTGGG - Intergenic
912706288 1:111917292-111917314 CTGGAAATAAGTAAAACTGCAGG + Intronic
913298692 1:117347159-117347181 TTAGAAATAAGCATATTTGGGGG + Intergenic
915885268 1:159714990-159715012 CTGTAAATAAGCAAATTGAAAGG - Intergenic
916309508 1:163379750-163379772 CTGAAAATATGAAAATTAGTTGG - Intergenic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
918033634 1:180843429-180843451 CAGAAAATAAGCAAATTATTTGG + Intronic
919464667 1:197913874-197913896 CTCAAAATATGCACATTTGTTGG + Intronic
919853049 1:201686654-201686676 ATGGAAATAAGCAAATGGGTTGG - Intronic
920597037 1:207282453-207282475 CTGGAAATAAGTAAATGTAGGGG + Intergenic
922107590 1:222525835-222525857 CTGAAAATACGAAAATTAGTCGG + Intronic
923910651 1:238439088-238439110 ATGGAAATGAGCAATTTAGTTGG - Intergenic
923971287 1:239205780-239205802 CTGGAAATGAGGAAATTATTGGG + Intergenic
924022594 1:239800113-239800135 CTGGAAATAGGCAGGTGTGTGGG + Intronic
1062821529 10:537731-537753 CTGGCAATAAGCAAAGCTCTTGG + Intronic
1064153406 10:12884337-12884359 GTGGAAGCCAGCAAATTTGTAGG + Intergenic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1066190976 10:33055993-33056015 CTGACAAAAAGCAAATTAGTAGG + Intergenic
1069579743 10:69557911-69557933 CTTAAAATAGCCAAATTTGTTGG - Intergenic
1071043308 10:81340448-81340470 ATGGAAATAAACAATTTTGAAGG + Intergenic
1071716001 10:88096048-88096070 CTGGAAATAAACACTCTTGTAGG + Intergenic
1073133521 10:101206195-101206217 CTGGCTATAAGCACAGTTGTAGG + Intergenic
1074176744 10:111013978-111014000 TGGGAAATAATGAAATTTGTGGG - Intergenic
1074200749 10:111232984-111233006 CAGAAAATGAGCAAATTTGAAGG - Intergenic
1074591191 10:114814994-114815016 CAGGAAAAAAGCAAAAATGTGGG - Intergenic
1075231210 10:120680003-120680025 CTGAAAATACAAAAATTTGTTGG + Intergenic
1075770324 10:124929129-124929151 CTGGAATGAAGCAAACTTTTGGG + Intergenic
1076082737 10:127598332-127598354 CTGAAAAGAAGGAAAGTTGTAGG + Intergenic
1079942522 11:26699109-26699131 CTGGAATTAGGCATATCTGTGGG - Intronic
1080239280 11:30107739-30107761 CTGGAAATAATGATATTAGTTGG - Intergenic
1080769180 11:35324820-35324842 CTGGAAATAAGCAAATTTGTTGG - Intronic
1081027512 11:38034244-38034266 CTAAAAATACGAAAATTTGTTGG + Intergenic
1081494351 11:43592724-43592746 CTGTTAATATGCAAATTTATGGG + Intronic
1082296192 11:50443690-50443712 CTAGAAATAAGCTCATCTGTAGG - Intergenic
1083032103 11:59602453-59602475 CTTGATATAATCATATTTGTGGG - Intronic
1084950281 11:72661387-72661409 CTGGACAGAGGCAAATTTGGGGG - Intronic
1088856155 11:113755991-113756013 TGGGAAATAAAAAAATTTGTGGG + Intronic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1090169242 11:124584261-124584283 CTGGAAAATATGAAATTTGTGGG - Intergenic
1091930089 12:4389040-4389062 CTGGAAGTAAGAATATTTGTAGG - Intergenic
1094254305 12:28403785-28403807 ATGGAAGTTATCAAATTTGTAGG + Intronic
1094391258 12:29952890-29952912 CAGTAAATAAGTAAATTTCTGGG - Intergenic
1094410152 12:30159484-30159506 CTGGAAAAAAGAAAATGAGTAGG - Intergenic
1094774945 12:33714912-33714934 ATGGAAAAAAGCAAGTTTGAAGG - Intergenic
1096064659 12:48730002-48730024 CTGGAAAAAGGGAAATTTGTAGG - Intergenic
1096991768 12:55810272-55810294 CTGGAAATAAAAAAATTAGCTGG - Intronic
1098483449 12:70993280-70993302 CAGGAAATAAGCAAAAGTCTAGG + Intergenic
1098584153 12:72136645-72136667 ATGGCAATAAGACAATTTGTTGG + Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1100286872 12:93174966-93174988 CTGGAAATAAGGTGATGTGTAGG + Intergenic
1100479256 12:94962144-94962166 CTGGAATTAAGCAAATTCAAGGG + Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1106086231 13:26544396-26544418 CTGAAAAGAAGCACATTTGCTGG - Intergenic
1107754678 13:43607433-43607455 TTGAAAATAAGGAAAATTGTAGG - Intronic
1107808939 13:44180831-44180853 CCAGGAATAAGCAGATTTGTTGG - Intergenic
1108956750 13:56167491-56167513 ATGGAAATAAGGAACTTAGTGGG - Intergenic
1109143080 13:58740673-58740695 CCTGAAATAAGCAAATTGTTTGG - Intergenic
1109636128 13:65119945-65119967 TTGGAAATAAACCATTTTGTGGG - Intergenic
1109738200 13:66514939-66514961 ATGGAAATAAGTAGATATGTGGG - Intronic
1110098432 13:71562341-71562363 CTGCAAATATGCAAATAAGTGGG + Intronic
1110480739 13:75973129-75973151 TTGGAAGTAAGTAAAATTGTTGG - Intergenic
1110547667 13:76774260-76774282 ATGGAAATAACCAAATGTGTCGG - Intergenic
1111438760 13:88249084-88249106 CTGTAAAAAAGAAAATTTGGTGG - Intergenic
1111443577 13:88314106-88314128 TTGGAAAAAAGTAAAATTGTAGG - Intergenic
1112733237 13:102390204-102390226 ATGGAAATAAGAAAAATTTTGGG + Intronic
1113318048 13:109205002-109205024 CTGGAAATGAGAAATTCTGTTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115932817 14:38516613-38516635 CTGGAAATCATCACCTTTGTGGG + Intergenic
1118980425 14:70711801-70711823 GTGGGAATAAGCAAAGCTGTTGG - Intergenic
1120527818 14:85597931-85597953 CTGTAAATAAACCACTTTGTGGG - Intronic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1125036159 15:35126456-35126478 TTGGAATTTAGCACATTTGTAGG - Intergenic
1125914738 15:43475787-43475809 TTGGAAATATGGAAATATGTTGG - Intronic
1127125657 15:55809265-55809287 CTGAAAATAGAAAAATTTGTTGG + Intergenic
1127341443 15:58048934-58048956 AGGGAAACAAGGAAATTTGTGGG - Intronic
1128069319 15:64784354-64784376 CTGGAAAAAAGAAGATTTCTGGG + Intergenic
1128168350 15:65487586-65487608 CTGGAAATGACCAATGTTGTTGG + Intronic
1128546707 15:68573370-68573392 GTGGAAATAAGCAGATCTGGTGG + Intergenic
1134759578 16:16702196-16702218 CTGGAACTAAGCAGATGTGATGG - Intergenic
1134986492 16:18657005-18657027 CTGGAACTAAGCAGATGTGATGG + Intergenic
1135778348 16:25276694-25276716 CTGGAAATAGTCAAACTTATTGG + Intergenic
1136236390 16:28916369-28916391 CTTGAAAAAAACAAATTTCTGGG + Intronic
1136642816 16:31581027-31581049 ATGGAAATAAGGAACTTTTTGGG - Intergenic
1137527660 16:49250332-49250354 CTGGAATTAAGAAAAATTGCTGG + Intergenic
1138354965 16:56370345-56370367 CTGGAAACAGGCAAAATTATGGG + Intronic
1138401604 16:56749527-56749549 CAGGAAATATGGAAAATTGTCGG + Intronic
1138885874 16:61078566-61078588 GTGAAAATAATCAAAGTTGTAGG - Intergenic
1141284622 16:82660022-82660044 ATGGAAATGAGCTAATTTGGAGG + Intronic
1143977043 17:10837679-10837701 CTGGGAAGAAGGGAATTTGTGGG - Intronic
1144783821 17:17821025-17821047 CTAGAACTAAGCAACTTTCTGGG + Intronic
1146335940 17:31970464-31970486 CTGAAAATAACCAAATTAGCTGG + Intronic
1149153086 17:53593456-53593478 TTGGAAATAAGCCATTTTATTGG + Intergenic
1150856736 17:68760313-68760335 CTGGAAAGTTGGAAATTTGTAGG + Intergenic
1151007165 17:70450921-70450943 CATGAAAGATGCAAATTTGTGGG - Intergenic
1153174211 18:2352231-2352253 CTGGAAGAAAGCCAATGTGTGGG - Intergenic
1153291460 18:3505934-3505956 CTAGAAATCTGCAAATTTTTGGG + Intronic
1154459592 18:14567829-14567851 CTGAAAATAAAAAAATTTGCTGG - Intergenic
1155074795 18:22345243-22345265 GTTGAAATAAGCAAATATTTTGG - Intergenic
1155792939 18:29997124-29997146 ATGGAAATGAGGAAATTTGGGGG + Intergenic
1156093285 18:33497662-33497684 CTGGAAAACAGCTGATTTGTTGG + Intergenic
1156577663 18:38337536-38337558 TTGGAAATGAGCAAATTTGATGG + Intergenic
1158558780 18:58496596-58496618 CTGAAAATTAGCATATTTGTTGG + Intronic
1158800420 18:60901215-60901237 CTGGGAGTAAGCAAAATTTTTGG + Intergenic
1158994266 18:62901327-62901349 TTGGAAATAAGCAGATTGCTGGG + Intronic
1159576999 18:70191332-70191354 AAGGAAATAAGCAGATTTATAGG + Intronic
1163227571 19:15975325-15975347 ATGGAAATGAGCAAATTATTGGG + Intergenic
1166752583 19:45171548-45171570 CTGGAAATGAACAAATATGGTGG + Intronic
1167378289 19:49123960-49123982 CTGGAAATAAGGACATTTCTAGG - Intronic
925246696 2:2389834-2389856 ATGGAAATGAGGAAATTTTTAGG - Intergenic
925584813 2:5453985-5454007 CTGGAAAAAAAAACATTTGTGGG - Intergenic
925750067 2:7080970-7080992 CTTGAAAAAAGCAAAGTTGAAGG + Intergenic
925850889 2:8081110-8081132 CTGGAAATCACCAAAGGTGTTGG - Intergenic
926489760 2:13510413-13510435 TTTGAAATAATCAAATTTTTAGG - Intergenic
927620882 2:24656968-24656990 TTGGACATATGCATATTTGTAGG + Intronic
928964570 2:36964466-36964488 CTGTAAGTATTCAAATTTGTTGG + Intronic
929400260 2:41571975-41571997 CTGCAGATAGGCAAATTTATAGG - Intergenic
929524705 2:42691036-42691058 CTGAAAATAAGAAAATTAGCTGG - Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930067124 2:47336140-47336162 ATGGAAATAAGAAAATTTGGAGG - Intergenic
930771322 2:55133223-55133245 CTAAAAATAAAAAAATTTGTGGG + Intergenic
931156737 2:59641166-59641188 CTTGCAATAAGCAAATTCTTAGG - Intergenic
932515729 2:72346498-72346520 CAGTAAATAAGGAAATTAGTGGG + Intronic
933633770 2:84684456-84684478 GTAGAAATAAGGAAATTTCTAGG - Intronic
933870026 2:86557163-86557185 CAGGAAAGGAGCAAGTTTGTTGG - Intronic
935017660 2:99199581-99199603 CTGGAAAAAAGAAAATTTGTTGG + Intronic
936608753 2:113981194-113981216 CAGGAGATAAGCAAATAAGTAGG - Intergenic
937316326 2:120934069-120934091 CTGTAAATAAGCAGATTTCCGGG - Intronic
938895835 2:135749327-135749349 GTGGAAATAAGGACATTTATAGG + Intronic
939071006 2:137542719-137542741 TTGGAAAAAAACAAATTTGGAGG + Intronic
939662350 2:144905701-144905723 CTGCTAATAAGCAAATGTGCGGG - Intergenic
940002669 2:148982226-148982248 CTGGAAATAAGGGAATGTGCAGG - Intronic
940691773 2:156927452-156927474 ATGGAAATAAGAAACTTTTTGGG - Intergenic
941516030 2:166479948-166479970 TTGGAAATAAGTAAATTTTAAGG - Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
944603520 2:201328585-201328607 CTGAAAATACGAAAATTAGTCGG - Intronic
945069191 2:205973876-205973898 ATAGAAATAAGCAATTTTGGTGG - Intergenic
948633797 2:239320507-239320529 ATGGAAATAAGGAAATTGGTAGG + Intronic
1169883269 20:10370205-10370227 CTGGCAATAGGCAGATTAGTAGG + Intergenic
1170058959 20:12239485-12239507 CTGCAAATAAGAAAATTCTTTGG + Intergenic
1172259442 20:33549696-33549718 CTGAAAATAGGCAAATTTTATGG + Intronic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1174934836 20:54855960-54855982 ATGGAATAAAGCAAATTTGCAGG + Intergenic
1175436360 20:58953192-58953214 CTGAAAATAATGAAATATGTAGG + Intergenic
1177207410 21:18026022-18026044 CTGGAAATAAACCAATTGTTAGG - Intronic
1177889668 21:26790287-26790309 CTGGGAATGTGCAAATTTGATGG - Intergenic
1179513438 21:41890458-41890480 CTGTGAAAAAGCAAATTAGTGGG - Intronic
1182411633 22:30191990-30192012 TTGGAAATAACAAAATTTTTTGG - Intergenic
1182466944 22:30523037-30523059 CTGGAAAAAATCAAAAGTGTAGG + Exonic
1182566828 22:31206394-31206416 CTGGAAATCCGCAAAGTTGCAGG + Exonic
1183917804 22:41136896-41136918 CTAGAAATAAGAAAATTAGCCGG + Intronic
1184551248 22:45205319-45205341 CTGGAAGAAAGCAGATTTGGAGG + Intronic
949370977 3:3334429-3334451 CTGGGAATAAGGAAAAATGTTGG + Intergenic
949450833 3:4183043-4183065 CTGGGAATAAGAAAGTTTATAGG + Intronic
949527918 3:4923765-4923787 CTAAATATAAGCAAATTTTTAGG + Intergenic
951199879 3:19864483-19864505 ATGGAAATAAGGAAATTGTTGGG - Intergenic
954504583 3:51057072-51057094 CAGTAAATGAGCAAAGTTGTAGG - Intronic
955865937 3:63384134-63384156 CTGGAAAGGAGCAAATGAGTAGG - Intronic
957440034 3:80233639-80233661 CTAGAATTTAGGAAATTTGTGGG + Intergenic
957613728 3:82502648-82502670 ATGAAAATATGCAAATTAGTTGG + Intergenic
957652060 3:83020403-83020425 CTGGAAACCACCATATTTGTTGG + Intergenic
959005126 3:101011355-101011377 CTTGAAATATGAAAATGTGTAGG + Intergenic
959848976 3:111066357-111066379 TTGGAAATAAGTAAATTTGGAGG - Intergenic
962696913 3:137958560-137958582 GTAGAAATAAGCAATGTTGTTGG + Intergenic
962904210 3:139787448-139787470 GTGGAAATAAGGAATTTGGTTGG - Intergenic
963245295 3:143052928-143052950 CTGGGGATAAGCAAATGTGTTGG + Intronic
963265852 3:143239256-143239278 CTGGAATGAAGGGAATTTGTTGG + Intergenic
963432471 3:145227173-145227195 CTGGCAATATTCAAAATTGTAGG - Intergenic
964666041 3:159173568-159173590 GTGGAAATAATGACATTTGTAGG - Intronic
965013626 3:163128239-163128261 CTGGAAATACGCAACCTTCTTGG + Intergenic
967852865 3:194095294-194095316 CAGGAAATACGCATATTTGGCGG + Intergenic
971615368 4:28783046-28783068 TTGGAAATATGCAAATATGTGGG + Intergenic
971835173 4:31753315-31753337 CTGGAAATAGGTTAATTTATTGG + Intergenic
973536696 4:51890128-51890150 CTGCCAATAAGCTAGTTTGTAGG - Intronic
973614147 4:52662390-52662412 ATGGAAATAAGGAAATTATTGGG - Intergenic
973838288 4:54833837-54833859 ATGGAAAGAAGCATATTTGAAGG + Intergenic
974829122 4:67168529-67168551 CTTGAAATGAGTAAATTTATTGG + Intergenic
975383960 4:73733436-73733458 CTGGAAATCAGACAATTTGGGGG + Intergenic
977740208 4:100470954-100470976 ATGGAAAGAAGGAAATTTATAGG + Intronic
977894420 4:102347358-102347380 CTGGAAATAAACAACTTGCTGGG - Intronic
978226026 4:106336379-106336401 CTGGAAATGATCAAATGTGTAGG + Intronic
978395979 4:108280521-108280543 CTGGAAATAAGCTATTATGTTGG + Intergenic
980319575 4:131252062-131252084 CTGGAATGAAGTAAATTCGTAGG - Intergenic
980589908 4:134872529-134872551 CTGGAAATATGCAAAAATGTAGG - Intergenic
980788435 4:137585611-137585633 CTGGATATAATCAAAGTTATTGG - Intergenic
980835803 4:138190549-138190571 CTGCAAAAAAGTAAATTGGTGGG - Intronic
983486271 4:168334323-168334345 CTGGAAATCAACAAGGTTGTTGG - Intergenic
983771268 4:171552278-171552300 ATGGAAATAAGCAGATTTGGAGG - Intergenic
984221818 4:176987625-176987647 CTTGAAATTTGCAAATATGTGGG + Intergenic
984417715 4:179482376-179482398 GAGGAAATTAGCAAATTTATTGG + Intergenic
985868541 5:2535786-2535808 CTGGGAATTAGAAAAGTTGTTGG + Intergenic
986161461 5:5233190-5233212 GTGGAAAAAAGCAAATTTGGGGG + Intronic
989020882 5:37006310-37006332 ATGGAAATAAACACATTTATAGG - Intronic
989779696 5:45249026-45249048 CTGTAAATCAGCAATTTTGGAGG + Intergenic
990561154 5:56984489-56984511 GTTGAAATAATCAAATTTTTAGG + Intergenic
992083671 5:73259105-73259127 TTTGAAATAAGTAAATCTGTGGG + Intergenic
992711588 5:79463509-79463531 CTGGAGATAAGGTGATTTGTTGG - Intronic
994254194 5:97573402-97573424 CTGAAAATAAGCAGTTTGGTGGG - Intergenic
994356223 5:98796615-98796637 TTGAAAATCAGCGAATTTGTGGG - Intronic
995504830 5:112849190-112849212 CTGAAAATAAAAAAATTAGTCGG + Intronic
995656861 5:114435360-114435382 CTAGATCTAAGAAAATTTGTTGG + Intronic
996610689 5:125376034-125376056 TTTCAAGTAAGCAAATTTGTGGG + Intergenic
998297468 5:140985459-140985481 CTGGAAACAACCAAATTTTTTGG - Intronic
998573949 5:143292610-143292632 CTGGAAGTTAGAAATTTTGTGGG + Intronic
999618626 5:153451486-153451508 CAGGAAAGAAGGAAATTTGGGGG + Intergenic
1002409825 5:179064871-179064893 CTGCAAACAAGCATATTTTTTGG + Intronic
1002992467 6:2250610-2250632 CTAAAAATAAGCAAATTAGCTGG - Intergenic
1003179420 6:3779477-3779499 CTGGCAATAAGCAAAAATGGTGG - Intergenic
1004213336 6:13675863-13675885 ATCTAAATAATCAAATTTGTGGG - Intronic
1004362346 6:14982551-14982573 CAGGAAATATGGAAATTTTTTGG - Intergenic
1005116755 6:22346885-22346907 CTGGCAACAATCAAATTTGAAGG - Intergenic
1005474904 6:26198491-26198513 CTAAAAATAAAAAAATTTGTCGG - Intergenic
1006775480 6:36589153-36589175 CTAAAAATAAAAAAATTTGTTGG + Intergenic
1008840549 6:55897970-55897992 CTTTAAATAACCAAATATGTAGG + Intergenic
1009533406 6:64850027-64850049 CCTGTAATAAGCAAAATTGTAGG - Intronic
1009604100 6:65844792-65844814 CTGGAAATTAGCACTTATGTAGG + Intergenic
1009775715 6:68203823-68203845 CTTGAAATAAGGTAATTTGTAGG + Intergenic
1010153406 6:72763430-72763452 CTGGAAATTTGCAAACTTTTGGG - Intronic
1010803086 6:80200423-80200445 CTAGAAAGTAGCAAATTTATGGG - Intronic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1013627785 6:111954766-111954788 TAGGTAATAAGCAACTTTGTGGG + Intergenic
1015154604 6:130078305-130078327 CAGGATATAACAAAATTTGTGGG + Intronic
1015645609 6:135384925-135384947 CTGAAAATAAGAAAATTAGCTGG + Intronic
1016144897 6:140657705-140657727 TTGGAAATAATCAAATGTCTTGG + Intergenic
1020473332 7:8564843-8564865 CTGGAAATAAGCAAAGAAGCAGG + Intronic
1021955301 7:25818414-25818436 CTAGAAATAAGCAAAATATTGGG + Intergenic
1024416215 7:49109979-49110001 CTGGAAATGGCCAAAATTGTGGG - Intergenic
1026471699 7:70699239-70699261 TTGGAAATAAGGAAATTTAGGGG + Intronic
1026478355 7:70757136-70757158 TTTGAAAAAAGCAATTTTGTGGG + Intronic
1027548875 7:79565553-79565575 CTGGAAATAATCAGAGTAGTAGG + Intergenic
1027730887 7:81871104-81871126 ACGGAAATAAGCAAACTTATTGG + Intergenic
1027803599 7:82786373-82786395 CTCTAAATATGCAAATTTATTGG - Intronic
1028014209 7:85686510-85686532 ATGGAAATAAGGAACTTTTTGGG + Intergenic
1028858950 7:95625519-95625541 TTGAAAATGAGCAAATTTGGAGG + Intergenic
1029783368 7:102758831-102758853 ATGGAATATAGCAAATTTGTAGG - Intronic
1031282139 7:119818229-119818251 ATGGAAATAAGGAACTTTTTGGG + Intergenic
1032946657 7:136861592-136861614 CTGGAGATAAGGAAAGTTTTAGG + Intergenic
1033265654 7:139884492-139884514 CTGGAAATAATCCCATTTGCCGG + Intronic
1033764465 7:144473119-144473141 ATGGAAGTAAGGGAATTTGTGGG - Intronic
1035623279 8:1051222-1051244 CTGGAGAAAAGAAAATTTCTGGG - Intergenic
1036993312 8:13625712-13625734 CTGCAAATATGCAACTTTATGGG + Intergenic
1042680635 8:71379491-71379513 CTTGAAATAGGCATATTTGAGGG + Intergenic
1043647724 8:82542514-82542536 CTGGAAATACCCAGATGTGTAGG + Intergenic
1044050644 8:87499134-87499156 CTGAAATTAAGCCTATTTGTAGG - Intronic
1044217360 8:89628018-89628040 CTGCAAATTACCTAATTTGTTGG + Intergenic
1044966714 8:97580885-97580907 CTGCAAAAAAGAAAAATTGTAGG + Intergenic
1045688166 8:104733358-104733380 TTGGAAATAACCAACTTTGGTGG + Intronic
1046481323 8:114822128-114822150 ATGGAAATAAGAAAATTATTTGG - Intergenic
1052631396 9:31045824-31045846 CTGGAAATAAGATAACTTGAAGG + Intergenic
1052823990 9:33162052-33162074 CTGGGACTAAGCTAATTTATGGG - Intronic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1053826876 9:42034545-42034567 CTGGAAATCAGCAAACACGTGGG - Intronic
1054603684 9:67152886-67152908 CTGGAAATCAGCAAACACGTGGG + Intergenic
1057775184 9:98002083-98002105 TTGGAATTAAGTAAATCTGTAGG + Intronic
1057877122 9:98766627-98766649 TGGAAAATAAGCAAATGTGTAGG + Intronic
1058576871 9:106413119-106413141 CTGGGAATAAGGACATTTGGAGG - Intergenic
1058751740 9:108045811-108045833 CTGGAAAGAAGCAATCTTATAGG - Intergenic
1059148144 9:111920662-111920684 CTGCCAATAAAAAAATTTGTGGG - Intronic
1059265708 9:113028388-113028410 CTGGTCAAAAGGAAATTTGTAGG + Intergenic
1059682694 9:116601709-116601731 TTGGAAAGGAGCAAACTTGTAGG + Intronic
1059850735 9:118336262-118336284 CTGGAAAAAAAAAATTTTGTTGG - Intergenic
1061810571 9:133160490-133160512 CTGGAAATAACCCAATGAGTTGG + Intronic
1185963223 X:4569402-4569424 ATTGAAATTATCAAATTTGTGGG + Intergenic
1186572087 X:10725695-10725717 CTGAAAATACAAAAATTTGTTGG + Intronic
1187044903 X:15637783-15637805 CTGGAAATAATTAACTTGGTGGG - Intronic
1187352322 X:18531653-18531675 TTGAAAATCAGCAAATTTCTTGG - Intronic
1187439292 X:19303532-19303554 GTTGAAATAAGCAACTTTTTTGG + Intergenic
1188791561 X:34413076-34413098 CTGGGAAACAGCAAAGTTGTCGG - Intergenic
1188948002 X:36332184-36332206 CTGGAAATAACAAAATATATTGG + Intronic
1190571797 X:51790289-51790311 ATGGAAATAGTCAATTTTGTGGG + Intergenic
1191169322 X:57424808-57424830 CTGGAAATATGAAAAAATGTGGG + Intronic
1191688519 X:63916701-63916723 GTGGAAATATTCAAATTGGTGGG + Intergenic
1193623271 X:83783569-83783591 ATGTATATAATCAAATTTGTGGG - Intergenic
1195504457 X:105641484-105641506 CTGGATACAGGCAGATTTGTTGG + Intronic
1195798309 X:108678416-108678438 CTGGAAATATGCATATTTATAGG - Intronic
1195851654 X:109288848-109288870 CTGGATATAAGCAATTTTACTGG + Intergenic
1199210571 X:145205264-145205286 CAGGCAATAAGCAAATTAATGGG + Intergenic
1199843065 X:151670457-151670479 CTGGAAAGAAGCAAATGTACAGG - Intronic
1201375768 Y:13317163-13317185 CTGAAAATACGAAAATTTGCCGG - Intronic
1201886134 Y:18884056-18884078 ATTGAAATTATCAAATTTGTGGG + Intergenic