ID: 1080769593

View in Genome Browser
Species Human (GRCh38)
Location 11:35328204-35328226
Sequence CTGAGTCAGTGGGAATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 372}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080769593_1080769599 10 Left 1080769593 11:35328204-35328226 CCATCCTATTCCCACTGACTCAG 0: 1
1: 0
2: 2
3: 38
4: 372
Right 1080769599 11:35328237-35328259 CTGCTGTGAAATAACCTCAAGGG 0: 1
1: 0
2: 0
3: 16
4: 142
1080769593_1080769601 26 Left 1080769593 11:35328204-35328226 CCATCCTATTCCCACTGACTCAG 0: 1
1: 0
2: 2
3: 38
4: 372
Right 1080769601 11:35328253-35328275 TCAAGGGTTCACTCCAACTCTGG 0: 1
1: 0
2: 0
3: 9
4: 102
1080769593_1080769598 9 Left 1080769593 11:35328204-35328226 CCATCCTATTCCCACTGACTCAG 0: 1
1: 0
2: 2
3: 38
4: 372
Right 1080769598 11:35328236-35328258 GCTGCTGTGAAATAACCTCAAGG 0: 1
1: 0
2: 2
3: 6
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080769593 Original CRISPR CTGAGTCAGTGGGAATAGGA TGG (reversed) Intronic
901181092 1:7342322-7342344 CTGAGTCAGTGCTAAAAGGGTGG - Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901624869 1:10618138-10618160 TTGAGGCAGTGGGAACAGGAGGG + Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
904055859 1:27669413-27669435 CTGATTCAGTTGGAACTGGAAGG - Intronic
904908910 1:33919585-33919607 CTCAGTTAATGGGTATAGGAGGG - Intronic
905354396 1:37371293-37371315 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
906592420 1:47038822-47038844 GTGGGTAAGTGGGAATGGGATGG + Intronic
908869795 1:68596300-68596322 TTGTGTCTTTGGGAATAGGAAGG - Intergenic
910151529 1:84153068-84153090 CTGTGTCTTAGGGAATAGGAAGG + Intronic
910858370 1:91719100-91719122 GTGAGTCTTTGGGAATTGGAAGG - Intronic
912145533 1:106789601-106789623 CTGATTCAGTAGGTCTAGGACGG + Intergenic
912173855 1:107134403-107134425 CTGAGGCAGAGGAAATAGAAAGG + Intergenic
912869312 1:113289414-113289436 CTGGGAGAGGGGGAATAGGAAGG + Intergenic
914218712 1:145658018-145658040 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914471294 1:147980882-147980904 CTGAGGGAGTGGGAATTGGAGGG - Intronic
915137499 1:153743486-153743508 CTTAGTGGGTGGGATTAGGATGG + Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
916482318 1:165225701-165225723 CTGATTCAGTGGGTCTGGGATGG + Intronic
917216908 1:172688428-172688450 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
917907303 1:179599033-179599055 CTGAGAAACTAGGAATAGGAGGG - Intronic
918307335 1:183259180-183259202 CTGACTCAGTGGGACTGGGCAGG + Intronic
919118525 1:193311702-193311724 CTGAGTGATTGGCAATAGGCAGG - Intergenic
919856776 1:201711523-201711545 CTGAGTCTGTGGGCTGAGGAGGG + Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
921052064 1:211517850-211517872 CTGAGCCAGTGGGAGAAGGTGGG + Intergenic
921136294 1:212262086-212262108 GTGAGTGAGTGGGGCTAGGAAGG + Intergenic
922011275 1:221590852-221590874 TTGAGTCAGTGGGCAAGGGAAGG + Intergenic
922721184 1:227901093-227901115 CTGGGTAACTGGGAGTAGGAGGG + Intergenic
923305491 1:232684614-232684636 CTGAGACTGAGGGAATGGGAGGG - Intergenic
924801759 1:247332957-247332979 CTGAGTAAGTGGGAACAAGGTGG + Intergenic
924946987 1:248853180-248853202 CTGAGTCAGTGAGGAATGGATGG - Intronic
1063276007 10:4568614-4568636 CTGAGTCAGAGTGAAGAGAAAGG - Intergenic
1063648406 10:7908902-7908924 CTGAGTCAGTGGCCCTGGGATGG + Intronic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1066007849 10:31164204-31164226 TTGAGTCAGTGGGCTTGGGAAGG - Intergenic
1066157429 10:32692838-32692860 CTGTGTGAGTGGGCATGGGATGG + Intronic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1067155975 10:43781736-43781758 TTGAGGCAGTGGGAGTGGGAAGG + Intergenic
1067971820 10:50980346-50980368 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1068415592 10:56717350-56717372 CTGATTCAGTTGGTCTAGGATGG - Intergenic
1068806014 10:61194578-61194600 CAGAGTCAGAAGGAGTAGGATGG - Intergenic
1069767492 10:70873983-70874005 CTGATTCAGTGGAACTGGGATGG + Intronic
1070416827 10:76198272-76198294 CTGATTCAGTGGGTCTAGGGTGG + Intronic
1071670287 10:87602804-87602826 CTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1071813958 10:89212395-89212417 CTGAGCCAGTTGGAATTTGATGG - Intergenic
1074148456 10:110738032-110738054 GTGAGGCATTGGGAATAGTAAGG + Intronic
1074210705 10:111331561-111331583 CTGTGTCTCTGGGAATAGCAAGG - Intergenic
1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG + Intronic
1074445833 10:113520330-113520352 CTGAGTCACTGGGTATAGGAAGG - Intergenic
1074786552 10:116847274-116847296 ATGAGTGAGAGAGAATAGGAAGG - Intergenic
1075272791 10:121067868-121067890 CTCAGAAAGTAGGAATAGGAGGG - Intergenic
1075435861 10:122441088-122441110 CTGATTCAGTAGGACTGGGATGG - Exonic
1075620354 10:123923056-123923078 CTGGTTCAGGGGGAAAAGGAGGG + Intronic
1075841079 10:125504193-125504215 CTGTGTCCCAGGGAATAGGAAGG - Intergenic
1075913594 10:126147363-126147385 CGTAGTCAGAGGGAACAGGAGGG - Intronic
1076299984 10:129418623-129418645 CTGAATCAGTGGGAATTAGCCGG + Intergenic
1076449756 10:130548747-130548769 ATGAGTCTGTGGGAATACCAGGG + Intergenic
1076886773 10:133266711-133266733 CTGAGTCAGTGGCCCCAGGAAGG + Intronic
1077711713 11:4543751-4543773 CTGAGTCATTGGGGCTGGGAAGG - Intergenic
1078017448 11:7627107-7627129 CTTAGACTGTGGGAAGAGGAGGG - Intronic
1078406249 11:11072330-11072352 CCCAGGCAGTGGGAATAGCAAGG - Intergenic
1079311787 11:19373047-19373069 CTGTGTCTGTGGGAATGGTATGG - Intronic
1080156277 11:29115133-29115155 ATGAGTCAGTGGGCTGAGGAAGG - Intergenic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1081086385 11:38806770-38806792 TTGGTTCAGTGGGAACAGGAAGG - Intergenic
1081456850 11:43232050-43232072 GTAAGGCAGTGGGAACAGGAAGG - Intergenic
1081680195 11:44997122-44997144 CTGAGACAGAGGGGAGAGGAGGG + Intergenic
1083762082 11:64824227-64824249 CTAAGCCATTGGGAATAGAATGG - Exonic
1087066766 11:94034738-94034760 CTGGGCCACTGGGAGTAGGAGGG + Intronic
1087148239 11:94833768-94833790 CTAAGCCAGTGGAAATAGCAAGG + Intronic
1087240332 11:95767952-95767974 CTGATTCAGTGGGTCTGGGATGG - Intergenic
1087365258 11:97210473-97210495 GTGACTCAATGGGAATAGGTAGG - Intergenic
1087402847 11:97689459-97689481 CTGAGGCATTGGGATTAGGGAGG - Intergenic
1088830005 11:113528852-113528874 CTGAGTTAGAGGCAATTGGAAGG - Intergenic
1089331399 11:117691367-117691389 TTGAGTCAGTGGGAGTGGGGAGG - Intronic
1089568414 11:119385541-119385563 CTGATTCAGTAGGTCTAGGATGG + Intergenic
1090857011 11:130618671-130618693 TGGAGTCATTGAGAATAGGAAGG - Intergenic
1091957644 12:4660892-4660914 CTGAGGAAGTGGGAATGGTAAGG + Intronic
1092489477 12:8932381-8932403 CTGATTGAGTGGGAAGAGTATGG + Intronic
1093653667 12:21672628-21672650 CTGAATCAGTGGGTATGGGGTGG + Intronic
1094785141 12:33839804-33839826 CTGATTCAGTAGGTATAGGATGG - Intergenic
1095380959 12:41591413-41591435 CTGAGTAAAAGGGAGTAGGAAGG + Intergenic
1097201507 12:57282767-57282789 CTGAGGCAGTGGGATTAGAAAGG + Intronic
1097566112 12:61270218-61270240 CTGAGTGAAGGGGATTAGGAAGG + Intergenic
1097710506 12:62912452-62912474 CTGAGGCAGAAGGAATAGGAGGG + Intronic
1098306963 12:69111957-69111979 CTGAGTCAAAGGGAATGGGATGG + Intergenic
1098673324 12:73256701-73256723 TTGAGTCAGTGGGCTCAGGAAGG + Intergenic
1101934711 12:109047979-109048001 GTGAGTGAATGGGAATGGGAAGG - Intronic
1102066582 12:109981441-109981463 CTGAATCAATGGGGACAGGATGG + Intronic
1102420545 12:112799850-112799872 GTGATTCAGTGGGACTAGGATGG + Intronic
1102502123 12:113359811-113359833 CAGAGTCAGTGGGAGTGGGAAGG + Intronic
1102650359 12:114437916-114437938 CTGAGCCAGTGGCAATACCAGGG - Intergenic
1103173925 12:118845205-118845227 AGAAGTTAGTGGGAATAGGAAGG + Intergenic
1103635977 12:122305691-122305713 CTGAGTCAGTGGGCTGAGAAAGG + Intronic
1103763167 12:123265690-123265712 CTGAGTGTGTGAGGATAGGAGGG - Intronic
1104709865 12:130977864-130977886 CTGAGTCTGTGGGCCTGGGAAGG + Intronic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1107160127 13:37215657-37215679 CTAGGTAAGAGGGAATAGGAAGG + Intergenic
1108164761 13:47680652-47680674 CTGATTCAGTAAGAACAGGATGG + Intergenic
1109288688 13:60445620-60445642 CTGATTCAGTAGGACTAGGATGG + Intronic
1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG + Intergenic
1111974988 13:94956986-94957008 CTGAGTCAGTGGGCAGGGGCAGG - Intergenic
1112095520 13:96128005-96128027 CTGAGTCAGTGTGATTGGAATGG + Intronic
1112117757 13:96375580-96375602 CTGGGTCAGTGTGTATAGCAGGG + Intronic
1113130276 13:107028925-107028947 CTGAGACAGCAGGAAAAGGATGG - Intergenic
1113444664 13:110356187-110356209 GTGAGTCAGTGGGAAATGGAGGG - Intronic
1113924695 13:113935011-113935033 TTGAGCCAGTGGGAATGGAAGGG - Intergenic
1113924953 13:113936402-113936424 TTGAGCCAGTGGGAATGGAAGGG - Intergenic
1116896431 14:50319824-50319846 CTGGGTCACTGGTAGTAGGATGG - Intronic
1118012916 14:61628351-61628373 ATGAGTCATTTGGAGTAGGATGG + Intronic
1118341797 14:64900123-64900145 CTGAGTCACTGAGAAAATGATGG - Intergenic
1119712110 14:76829804-76829826 CTGAGACACTGGGAATGGGCAGG + Intronic
1120836290 14:89040934-89040956 CTGAGTCCGTGGAAAGAGGCTGG + Intergenic
1120861228 14:89256592-89256614 CTTGCTCAGTGGGAAGAGGAAGG - Intronic
1121233034 14:92372310-92372332 CTGAATAAATGGGAACAGGAGGG + Intronic
1121406232 14:93720849-93720871 GGGTGTCAGTGGGGATAGGAGGG + Exonic
1121668326 14:95689339-95689361 ATGATTCAGTGGAAATAGAATGG + Intronic
1121951260 14:98172607-98172629 CTGAGTCTCTGGGCCTAGGAGGG - Intergenic
1122383129 14:101324363-101324385 ATGAGTCAGTGGCAGTGGGATGG - Intergenic
1123791523 15:23725521-23725543 ATAAGTCATTGGGAATGGGATGG - Intergenic
1125264736 15:37866142-37866164 CTGCGGCAGTGAGAATAGCAGGG + Intergenic
1125268786 15:37915322-37915344 CAGAGTCAGTGAAAACAGGAAGG + Intergenic
1125284179 15:38074107-38074129 CTGAGTTGGTGGGAAAAGGGTGG + Intergenic
1125487242 15:40120549-40120571 CTGAGTCAGTAGGTCTGGGAGGG - Intergenic
1125664673 15:41420826-41420848 CTGATTCAGTAGGTCTAGGATGG - Intronic
1125993900 15:44137445-44137467 TTGAGTCAGTGGGGAGAGGGTGG - Intronic
1126058687 15:44757456-44757478 CTGGGTGAGTGGGGATATGAAGG + Intronic
1126272043 15:46831413-46831435 CTGTGTCAGTGATGATAGGAAGG - Intergenic
1126471221 15:49013150-49013172 CAGATTCAGTAGGAATAAGAAGG - Intronic
1126876327 15:53045565-53045587 ATGAGGCGGTGGGAAGAGGAAGG - Intergenic
1128509653 15:68305595-68305617 GTGAGTCAGTGGCCAAAGGAGGG - Intronic
1128606163 15:69038058-69038080 CTGAGGCAGTGGCCATGGGATGG + Intronic
1129822686 15:78615595-78615617 CTGAGTCAGTGGGTCTGGGTAGG - Intronic
1130444072 15:83982455-83982477 CTGATCCAGTGGGAGAAGGATGG + Exonic
1130859001 15:87869266-87869288 CAGAGTCAGTGGGGAGAGGAGGG + Intronic
1130915747 15:88303213-88303235 CTGAGTCACTGCGCATAGGAGGG - Intergenic
1131454463 15:92572247-92572269 CTGAGTCAGTGGGAATGTGATGG + Intergenic
1132714495 16:1284027-1284049 CAGATTCAGTGGGAAGAGGTGGG - Intergenic
1133011290 16:2913266-2913288 CTGAGTTGGTGGGAGTGGGAAGG + Intronic
1133601304 16:7342794-7342816 CTTAGGGAGTGGGAAGAGGATGG - Intronic
1134642944 16:15843817-15843839 CTGAGTCAGTAGGACTGGGATGG + Intronic
1135046307 16:19158854-19158876 CTGATTCAGTCCGTATAGGAAGG + Intronic
1136054356 16:27677351-27677373 CTGATTCAGTGGGTCTGGGATGG - Intronic
1137660269 16:50199442-50199464 CTCAGTCATTGAGAAAAGGATGG + Intronic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138079649 16:54077761-54077783 CTGAGTCAGAAGGAAGAGGTAGG + Intronic
1138879665 16:60995814-60995836 GTGACTCAGTGGGAGTGGGATGG - Intergenic
1139041470 16:63004058-63004080 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1139291240 16:65859805-65859827 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1139689889 16:68634207-68634229 CTGATTCAGGGGGGATAGGATGG + Intergenic
1139822384 16:69730790-69730812 TTGAGTCAGTGGGACTGGGAAGG + Intergenic
1140090426 16:71833992-71834014 CTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1140212671 16:72983213-72983235 CTTAGTCAGTTGGACTAAGAAGG - Intronic
1141868575 16:86768604-86768626 CTGCGTCAGGGAGAAAAGGAAGG - Intergenic
1142199427 16:88754039-88754061 CTGAGTCAGCTGCAATGGGATGG + Intronic
1142475337 17:185487-185509 CTGAGTCAGTGGGTGTGAGATGG - Intergenic
1145870646 17:28270446-28270468 CCTGCTCAGTGGGAATAGGAGGG + Intergenic
1147225130 17:38970600-38970622 CTCAGACATTGGGAAAAGGAGGG + Intergenic
1149410209 17:56397186-56397208 CTGAGGCAGTGGGATTAGTTGGG - Intronic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1150784419 17:68151139-68151161 CCTGCTCAGTGGGAATAGGAGGG + Intergenic
1152491658 17:80638932-80638954 CAGCGTCTGTGGGACTAGGACGG - Intronic
1152887650 17:82861749-82861771 GTGAGTCGGTGGGCATAGGATGG + Intronic
1152945906 17:83197250-83197272 CTGAGTCAGTGGGAAGACAGTGG + Intergenic
1153691519 18:7599489-7599511 CTGAGTCAGGGGTTATAGCAAGG - Intronic
1153716548 18:7855501-7855523 CTGAGTCTTTGCAAATAGGATGG - Intronic
1153833136 18:8940716-8940738 CTGATTCAGTGGAGACAGGAGGG - Intergenic
1157190832 18:45580200-45580222 CTGGGACAGTGGGGACAGGAAGG + Intronic
1157573218 18:48726859-48726881 GTGAGTCACTGGGAATGAGAGGG - Intronic
1157796998 18:50583793-50583815 CTGATTCAGTGTGAAGAGAAGGG - Intronic
1158076663 18:53537823-53537845 CTGAGTCAGTGGGCTGAGAAAGG - Intergenic
1158304774 18:56093130-56093152 CTGAGCAAGTGAGAATTGGAAGG - Intergenic
1158446473 18:57526534-57526556 CTGAGTCAGTGGGATGGGAAAGG + Intergenic
1158652071 18:59297224-59297246 CTGATTCAGTGGGTCTGGGATGG - Intronic
1159122424 18:64186145-64186167 CTGACACAGTGGGAATAGTTTGG + Intergenic
1159236363 18:65679280-65679302 CTGATTCAGTTGGTCTAGGATGG - Intergenic
1159320357 18:66839545-66839567 CTGAGTGGGAGGGAATAGAAAGG + Intergenic
1162587357 19:11568427-11568449 CTGAGTCAGTGAGAAGAGCGCGG + Intronic
1162918248 19:13885626-13885648 CTGAGTCCCTGGGAAGGGGAGGG - Intronic
1163235821 19:16029852-16029874 CCAAGTCAGTGAGAAGAGGAAGG - Intergenic
1166750548 19:45162287-45162309 CTCAGCCAGGTGGAATAGGAAGG + Intronic
1166966614 19:46533037-46533059 CTTAGTCAGTGGGACTGGGTGGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
926466721 2:13199712-13199734 CTGAGTCAATGAGAATTGTATGG - Intergenic
927296630 2:21462503-21462525 CTGATTCAGTAGACATAGGATGG + Intergenic
927401634 2:22719023-22719045 CTGGATCAGAGGGAATAGAAGGG + Intergenic
927878647 2:26675323-26675345 CTGGTTCAGTGGAAACAGGATGG - Intergenic
928077475 2:28278352-28278374 CTGAAACAGTGGGAATAGGGAGG + Intronic
929759142 2:44791659-44791681 CTGAGTCAAGGGGAACAGGGAGG + Intergenic
930416747 2:51098701-51098723 CTGAGTCAGTAGGAAAGGGCAGG - Intergenic
930926422 2:56823467-56823489 CTGATTCAGTAGGTCTAGGATGG + Intergenic
931985508 2:67738116-67738138 GTGGGTCAGTGGGAATGGGGTGG - Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932699157 2:73981667-73981689 CTGATTCAGTGGGGTTAGGATGG + Intergenic
932705438 2:74020934-74020956 ATGAGTGAGTGGGAAGGGGAGGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934874400 2:97902733-97902755 CTGAGTCAGTGGGCTGGGGAAGG + Intronic
935086716 2:99853502-99853524 CTGAGACAGTGAGATCAGGATGG - Intronic
935195227 2:100809823-100809845 CAGAGACAGTGGGAATGGGAAGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937472564 2:122186680-122186702 CTGAGTCAGGGGGATTGGGGTGG - Intergenic
938921699 2:136001229-136001251 CTGATTCAGTAGTCATAGGATGG - Intergenic
938924677 2:136028349-136028371 CTGAGAGTGTGAGAATAGGAAGG - Intergenic
939735869 2:145844014-145844036 ATGATTCAGTTGGAATTGGAAGG - Intergenic
940348896 2:152659528-152659550 CTAAATGAGTGGGTATAGGATGG - Intronic
940541459 2:155025299-155025321 CTTACTCAGTGGGAAAAGGAAGG - Intergenic
942222652 2:173786304-173786326 ACGAGTCAGTGGGAACAGGATGG + Intergenic
942839775 2:180346148-180346170 CAGAGTAAATGGGAATAGGTTGG + Intergenic
944132998 2:196367298-196367320 GTGATTCAGTAGGTATAGGATGG + Intronic
945470478 2:210223448-210223470 CTGATTCAGTGGGTCTGGGATGG - Intronic
946243131 2:218368846-218368868 CTGTGTCAGTGGGAACCGGGAGG - Intergenic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
946456895 2:219833808-219833830 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
946616249 2:221514049-221514071 CTGAGTCCGTGGGAAAGGGTGGG - Intronic
947633622 2:231668859-231668881 CTGATTCAGTGGGAATGGGTAGG + Intergenic
947824649 2:233097101-233097123 GTGAATCAATGGGAAAAGGATGG - Intronic
948883827 2:240873326-240873348 CAGAAGCAGTGGGAAGAGGAAGG + Intronic
949025662 2:241766078-241766100 CTGAGTGAGTAGGAAGAGGGGGG + Intronic
1169602960 20:7283138-7283160 GAGAGACAGTGTGAATAGGAAGG - Intergenic
1169764724 20:9136599-9136621 CTGAATCAGTGGGAATGTGGAGG + Intronic
1171285074 20:23930283-23930305 TTTAGTCAGTGAGAATGGGAGGG + Intergenic
1171304770 20:24095822-24095844 CAGAGCCAGTGGGAAAGGGAGGG - Intergenic
1172481442 20:35274197-35274219 CTGGGGCAGTGTGAAAAGGAGGG - Intronic
1174055751 20:47797084-47797106 CCGATTCAGTGGGACTGGGATGG - Intergenic
1177030020 21:15970896-15970918 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1177658115 21:24046148-24046170 ATGAGTCAGTGGGAACTGGCTGG - Intergenic
1177759932 21:25391932-25391954 CTAAGTCAGTGGCAGTGGGAAGG - Intergenic
1178934620 21:36850723-36850745 CTGAGTCCAAGGGAATAGCAGGG + Intronic
1179312202 21:40206412-40206434 CTGACTCAGTGGGTCTAGGGGGG + Intronic
1179993405 21:44960224-44960246 GTGAGGCTGTAGGAATAGGAGGG - Intronic
1180586658 22:16898861-16898883 TTGAGTCAGTGGGCTTGGGAAGG + Intergenic
1180740281 22:18048784-18048806 CTGAAGCACTTGGAATAGGAGGG - Intergenic
1181877485 22:25951134-25951156 CTGAGTCAGTGGGCTGGGGAAGG - Intronic
1181935977 22:26438966-26438988 CTGAGTCAGTGGGCTGGGGAAGG - Intronic
1182056370 22:27358478-27358500 CTGGGTCAGTGGGAATTGAGTGG - Intergenic
1182302720 22:29346735-29346757 CTGAGACAGAGGGAAGAGGCTGG + Intronic
1182973922 22:34604531-34604553 CTAAGTAAGTGGTAATAGAAAGG - Intergenic
1183222466 22:36524876-36524898 CTGATTCAGTGGGTATGGGGTGG - Intronic
1183677807 22:39309548-39309570 CTGAGCAAGTGGGAACAGGGAGG - Intergenic
1185050877 22:48553403-48553425 CCGGGCCAGAGGGAATAGGATGG + Intronic
949980250 3:9498321-9498343 CTGAGTCACTGGGATCAAGAGGG - Intergenic
950577335 3:13840122-13840144 TTGAGTCAGAGGGAATTGCAAGG - Intronic
950688973 3:14640625-14640647 CTGAGGGAGGGGGACTAGGAGGG + Intergenic
950892903 3:16420590-16420612 CTCAGTTAGTGGGTATAGGTGGG - Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953748280 3:45591537-45591559 CTGAGCCTGTGGGAGTAGGGGGG + Intronic
953911669 3:46896402-46896424 CAGAGGCAGTGGGACAAGGAGGG + Intronic
954344073 3:49981362-49981384 CTGATTCAGTAGGTTTAGGATGG - Intronic
954464594 3:50647032-50647054 CTGAGTCTGGGAGAAGAGGATGG + Intronic
954572863 3:51656664-51656686 GTGATTCAGTGTGATTAGGAAGG + Intronic
955511859 3:59689113-59689135 CTGAGCCATTGGGAATAGCCTGG + Intergenic
956749154 3:72332543-72332565 CTGGGTCATTGTGAGTAGGAAGG - Intergenic
956963877 3:74435599-74435621 CTGAGTAAATGGGGATATGAAGG + Intronic
957309039 3:78495441-78495463 CTGAGTCAGAGGGCATATGTTGG + Intergenic
958259001 3:91357656-91357678 CTGAGTCAGTGGGCTGGGGAAGG - Intergenic
959371858 3:105536919-105536941 CTGATTTAGTGGGTATAGGACGG + Intronic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960142044 3:114160178-114160200 CTGACTCAGTAGGTATAGGAAGG - Intronic
960640666 3:119819840-119819862 CTGGGTCAGTGAGGAGAGGATGG + Intergenic
961267239 3:125653477-125653499 TTGATTCAGTGGGCATAGGGTGG + Intergenic
961326333 3:126111608-126111630 CGGAAGCAGTGGGAAAAGGAAGG - Intronic
961907800 3:130280704-130280726 CTGAATCAGGGGTAATACGAGGG - Intergenic
963630612 3:147725688-147725710 TTGAGTCAGTGGGATGGGGAAGG + Intergenic
963974217 3:151462323-151462345 CTGAATCAGTGGGTCTGGGATGG - Intergenic
965922511 3:173935135-173935157 CTAAGGCAGTGGGAATAATAAGG - Intronic
966700117 3:182840262-182840284 CTGAGACAGAGGGAATAGTGAGG - Intronic
969332206 4:6481412-6481434 TTAAATCAGTGGGAAAAGGATGG - Intronic
969401649 4:6959574-6959596 CTGAGTGAGTGGGAACAAGGGGG + Intronic
970299545 4:14667095-14667117 CTGAGGCTGTGCAAATAGGAAGG - Intergenic
971976198 4:33691305-33691327 CTGAGTCAGTGGGCTGAGAAAGG + Intergenic
972768589 4:42174423-42174445 CAGAGTCACTGGGAATAAGATGG - Intergenic
973585579 4:52387529-52387551 TTGAGTCAGTGGGACAAGAAGGG - Intergenic
973842064 4:54872519-54872541 CTGAGTCAGTGGGTCTGGGATGG + Intergenic
974346515 4:60689356-60689378 CTGAGTCTCAGGGAATAGGGAGG - Intergenic
974824268 4:67106552-67106574 CTGAATAATTGGGAATAAGAGGG - Intergenic
975178826 4:71319803-71319825 CTGAGTCAGAGGGAGAAGGAGGG + Intronic
975242297 4:72075088-72075110 TTGAGTCAGTGGGCTGAGGAAGG + Intronic
975627681 4:76365790-76365812 CTGACTCAGTAGGTCTAGGATGG - Intronic
976369058 4:84266084-84266106 CTCAGTCAGTTGGAAGAGGTAGG + Intergenic
976468503 4:85399386-85399408 TTGTGTCTGAGGGAATAGGAAGG - Intergenic
977139593 4:93351610-93351632 TTAAGTCAGTGATAATAGGAAGG + Intronic
977202171 4:94130202-94130224 CTGTGACATTGGGAATGGGAGGG + Intergenic
977657290 4:99536660-99536682 CTGAGACAGAGGGAACAGGCTGG - Intronic
977814970 4:101404478-101404500 CTGAGAGAGAGAGAATAGGAAGG - Intergenic
981636446 4:146886331-146886353 CTGAGTCAGTGGGAAGAGACAGG - Intronic
982979172 4:162109129-162109151 GGGAATCAGTGGGAAAAGGAAGG + Intronic
983027707 4:162757738-162757760 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
983380225 4:166981992-166982014 CTGAGTCTGTGGGAACAGGGGGG + Intronic
985714781 5:1449447-1449469 CAGAACCAGTGGGAATTGGAGGG + Intergenic
985780159 5:1866306-1866328 CTGAGTCGCAGGGAACAGGAGGG + Intergenic
986763040 5:10897356-10897378 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
987320552 5:16765205-16765227 CTGAGTCAGTGGGCTAGGGAAGG + Intronic
987372126 5:17202979-17203001 GTGAAGCAGTGGGAATTGGAGGG + Intronic
987449604 5:18065284-18065306 ATGACACAGTGGGAATAGAAAGG - Intergenic
988071439 5:26293771-26293793 CTGTGCCTGTGAGAATAGGAAGG - Intergenic
988664964 5:33316362-33316384 GTGATTGAGTGGGAAGAGGATGG + Intergenic
989486783 5:41999835-41999857 TTGAGTCAGTGGGATGGGGAAGG - Intergenic
990059609 5:51630896-51630918 GTGAGTCAGGGGGAAGGGGAGGG + Intergenic
990926440 5:61030384-61030406 ATGAGAAAATGGGAATAGGAGGG - Intronic
991013475 5:61908439-61908461 TTGAGTCAGTGGGCTTGGGAAGG - Intergenic
991109671 5:62884553-62884575 TGGAGGCAGTGGGAATAGGATGG - Intergenic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993377140 5:87161841-87161863 TTGAATCATTGGGAAAAGGATGG + Intergenic
993509318 5:88751924-88751946 GTGAGCCAGTGGCAATAGGTTGG + Exonic
994061870 5:95487019-95487041 GTGAGTCAGTGGGCTGAGGAAGG + Intronic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
995664345 5:114524391-114524413 CAGAGTCAGTGGGAAGCGAAAGG - Intergenic
996922526 5:128785492-128785514 TTGAGTCAGTGGGCTCAGGAAGG - Intronic
997930626 5:138069764-138069786 TTGAGTCAGTAGGAAGAAGAGGG - Intergenic
998515581 5:142750847-142750869 CTGAGTCACTGGGGAAGGGATGG - Intergenic
998738746 5:145175143-145175165 CTGATTCAGTAGGTCTAGGATGG - Intergenic
1000009855 5:157220656-157220678 CTGAGTCTGTGGGCTCAGGAAGG - Intronic
1000386264 5:160677292-160677314 GTGAGGCAGTGGGAGTAGCATGG + Intronic
1001956235 5:175849953-175849975 CTGATTCAGTGGGAAACAGATGG - Intronic
1003448185 6:6204585-6204607 CAGGGGCAGTGGGGATAGGATGG + Intronic
1003491601 6:6627170-6627192 CTTGGCCAGTGGGAGTAGGAAGG - Intronic
1003623437 6:7722894-7722916 CAGTGATAGTGGGAATAGGACGG - Intergenic
1003741889 6:8949986-8950008 CTGAGTCAGTAGGTATGGGTTGG - Intergenic
1004055675 6:12135958-12135980 CAGAATCAGTGGGAATGGAAAGG - Intronic
1006326600 6:33358657-33358679 CTAAGTCAGTGGCAATAGGGAGG - Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006644541 6:35506836-35506858 CTGAGACAGTGTGCAAAGGAGGG - Intronic
1007471822 6:42095777-42095799 CTGATTCAGTGGGTTTGGGATGG - Intergenic
1008820696 6:55627600-55627622 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1009564541 6:65295604-65295626 CTGAAGCATTGGGAATATGATGG - Intronic
1009908509 6:69897232-69897254 TTGATTCAGTGGGAAATGGATGG - Intronic
1011354689 6:86461888-86461910 CTGATTCAGTAGGACTGGGATGG + Intergenic
1013746991 6:113357484-113357506 CTGAGACAGTGGGCAGAAGAAGG + Intergenic
1014076076 6:117235971-117235993 CTGATTCAGTAGGTCTAGGATGG + Intergenic
1014533843 6:122593849-122593871 TTGAGTCAGTGGGCTTGGGAAGG - Intronic
1017461602 6:154656190-154656212 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1017630143 6:156389111-156389133 CTGACTCAGTGGGCATAGAGAGG + Intergenic
1017667706 6:156737205-156737227 CTTAGTCTGTGGGAGGAGGAAGG - Intergenic
1017963779 6:159246262-159246284 CTGAGTCAGTGAGAGTGGGTGGG + Intronic
1019486962 7:1293743-1293765 CTGAGTGAGTGGGGAAGGGAGGG + Intergenic
1019884615 7:3893065-3893087 CAGAGTCAGAGGGTATATGATGG - Intronic
1021387382 7:20048063-20048085 CTGATTCAGTTGGTCTAGGAAGG + Intergenic
1021467959 7:20967512-20967534 CTGAGTAAATGGGAATAAAAGGG - Intergenic
1021862577 7:24921683-24921705 ATGTCTCAGTGGGAGTAGGATGG - Intronic
1022508209 7:30919988-30920010 CTGAGTCCTTGGGAAGGGGAGGG - Intronic
1022753605 7:33259841-33259863 CTGAACCAATGGGAATGGGAAGG - Intronic
1022834128 7:34097597-34097619 CTGATTCAGTGGGTCTAGGTGGG + Intronic
1023287436 7:38633486-38633508 TTGAGTCAGTGGGCTTAGAAAGG + Intergenic
1023590794 7:41778729-41778751 CTGAGCCAGAGGGAGAAGGAAGG - Intergenic
1023605679 7:41928849-41928871 TGGAGCCAGTGGGAAGAGGATGG - Intergenic
1024115763 7:46191540-46191562 CTGATTCAGTAGGTATAGGATGG - Intergenic
1025237233 7:57243074-57243096 CTGATTCAGTGGAACTGGGATGG + Intergenic
1027721432 7:81746933-81746955 CTGAGTCAGTGGGTCTGGGCTGG + Intronic
1028292040 7:89076848-89076870 GAGAGTCCCTGGGAATAGGAGGG + Intronic
1028839519 7:95412840-95412862 TTGAATCAGTGGGAGAAGGATGG - Intronic
1028862438 7:95668235-95668257 CTGAGTCAGAGGGTAGAAGATGG + Intergenic
1029820153 7:103138953-103138975 TTGAGGGAGTGGAAATAGGAGGG - Intronic
1031120209 7:117713580-117713602 CTGTGTTTGTGTGAATAGGAAGG + Intronic
1031878378 7:127167767-127167789 TTGTGTCTGAGGGAATAGGAAGG - Intronic
1033112497 7:138593678-138593700 CTGAGTCTCAGGGGATAGGAAGG + Intergenic
1034513981 7:151559443-151559465 CTGATTCAGTGGATATGGGACGG + Intronic
1036130871 8:6108834-6108856 CTGAGTCTGTGGGTCTAGGAGGG - Intergenic
1037831574 8:22192704-22192726 GTGAGTCAGTGGGAGTAAGTGGG + Intronic
1038000728 8:23389241-23389263 CTGAGTCAGTCTGCCTAGGAAGG + Intronic
1038054050 8:23841385-23841407 CTGAATCAGTGTGACAAGGAAGG - Intergenic
1038526563 8:28279183-28279205 TTGAGTCAGTGGGCTAAGGAAGG + Intergenic
1038665377 8:29532768-29532790 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1040754043 8:50748882-50748904 TTGTGTCTGTGGGAATAGGGAGG - Intronic
1041147406 8:54891494-54891516 CAGAGTCATTGGGAGTAGGATGG + Intergenic
1041588010 8:59544423-59544445 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1042000755 8:64121538-64121560 TTGAGTCAGTGGGTTAAGGAGGG - Intergenic
1042715060 8:71763596-71763618 CTGATACAGTGGAGATAGGAAGG + Intergenic
1043309056 8:78835586-78835608 CTGAGGCAATGAGAATAGAAGGG - Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1043788205 8:84429105-84429127 CTGAGTGAGAGGTACTAGGAAGG + Intronic
1044101302 8:88143158-88143180 CTGGGTCAATCTGAATAGGAAGG + Intronic
1044274209 8:90281347-90281369 CTGATGCAGTAGAAATAGGATGG + Intergenic
1045243876 8:100426016-100426038 CTGGGTTATTGGGAATAGGCTGG - Intergenic
1045278641 8:100729237-100729259 CTGAAACAGGGTGAATAGGAGGG + Intergenic
1045904698 8:107330695-107330717 CATAGTCAGTGGGAATGGAAAGG + Intronic
1047314925 8:123724003-123724025 CAGAGTCAGTGGCAGTAGTAGGG + Intronic
1047320436 8:123775316-123775338 GTGAGCCAGTGGGAATGGGATGG + Intronic
1047531358 8:125679728-125679750 CTAAGTCAATGGGAATGGAACGG - Intergenic
1048321789 8:133405783-133405805 CTGTTCCAGTGGGTATAGGAAGG - Intergenic
1050023781 9:1311947-1311969 CTGATTCAGTGGGTCTTGGATGG - Intergenic
1050433982 9:5589932-5589954 CTTGGTCAGTGGGAGTAGAAGGG + Intergenic
1051515143 9:17922468-17922490 CTGATTCAATAGGACTAGGATGG + Intergenic
1052151876 9:25127113-25127135 TTGAGTCAGTGGGCATGGAAAGG - Intergenic
1055877255 9:80958408-80958430 CAGAGACAGAGGGAAAAGGACGG - Intergenic
1056313931 9:85370476-85370498 TTGAGTCAGTGGGCTGAGGAAGG - Intergenic
1057631864 9:96725789-96725811 CTGATTTAGCTGGAATAGGATGG - Intergenic
1060495817 9:124117997-124118019 GGGAGTCAGTGGGATCAGGAGGG + Intergenic
1187553601 X:20330618-20330640 CTGATTCAGTGGGTCTGGGAGGG - Intergenic
1187738138 X:22325258-22325280 CTGAGTCAGTAGGCCTGGGATGG + Intergenic
1187847312 X:23553847-23553869 CTGAGTCAGTGGGTCTGGGGTGG - Intergenic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1191717007 X:64200653-64200675 CTGAGTCAGAAGGCATAGCAGGG + Intronic
1191784875 X:64906523-64906545 CAGAGTCAATGAGGATAGGAGGG - Intergenic
1192262567 X:69515223-69515245 CTCAGGCAGTGGGATTGGGAGGG - Intronic
1192301919 X:69913860-69913882 TTGTGTCTCTGGGAATAGGAAGG + Intronic
1193862583 X:86688416-86688438 CAGTGTCAGTGGGAATGGAAGGG + Intronic
1194425387 X:93731288-93731310 CTGAGTCAGTTGGTCTGGGATGG + Intergenic
1195125337 X:101803319-101803341 CTGATTCAGTAGGTCTAGGATGG - Intergenic
1197287952 X:124618126-124618148 CTGATTAAGTGGGAAAATGAAGG - Intronic
1198517227 X:137421738-137421760 CTGAGTCAGAGGAACTAGAAGGG + Intergenic
1199684819 X:150256512-150256534 CAGTGCCAGTGGGAATTGGAAGG + Intergenic
1200757515 Y:7003773-7003795 GGGAGTCAGTGAGAATATGATGG - Intronic
1201463758 Y:14257153-14257175 TTGAGTCAGTGGGCTGAGGAAGG + Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic