ID: 1080770950

View in Genome Browser
Species Human (GRCh38)
Location 11:35340875-35340897
Sequence CAGTGTGCCCCCTGGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080770950 Original CRISPR CAGTGTGCCCCCTGGGATTA TGG Intronic
900500910 1:3004116-3004138 CAGCGTGGCCCCTGGGATGCTGG - Intergenic
900549436 1:3246750-3246772 CAGTCTGAGCCCTGGGGTTAGGG - Intronic
900597838 1:3490579-3490601 CAGTGTGCCCGCTGGGGAAAAGG + Exonic
900636365 1:3667931-3667953 CAGTGTCCCCCCAGGGCTCATGG + Intronic
902820362 1:18939482-18939504 CAGAGTGATCCCTGGGATTCAGG + Intronic
903319746 1:22535568-22535590 CTGTGTGCCCCCTGGGCTGGAGG - Intergenic
903979640 1:27176573-27176595 TAGTGAGACCCCTGGGAGTAGGG + Intergenic
912563488 1:110567087-110567109 TAGTGCCCACCCTGGGATTACGG + Intergenic
915456295 1:156043036-156043058 CAGTGGGCACCCTAGGATTGTGG + Intronic
916040479 1:160956959-160956981 CAAGATGCCCCTTGGGATTATGG - Intergenic
916046113 1:161000917-161000939 CAGGGTGTGCCCTGGGATAAGGG + Intronic
916533460 1:165680486-165680508 AAGTGTGCCCACTGGCATGAAGG - Exonic
917694978 1:177513069-177513091 CAGAGTGCCCATTGTGATTAGGG - Intergenic
920202884 1:204270886-204270908 CAGTGTGCTCCCTGGCATTGGGG + Intronic
922749065 1:228062356-228062378 CAGTGTGCCCCATGGTAGGAAGG + Intergenic
924028919 1:239867351-239867373 GAGTGTGCCCACTAGGAATAGGG + Intronic
924707772 1:246512727-246512749 CAGTGTGTCCGCTGGGAGTGCGG - Intergenic
1067319420 10:45204162-45204184 CTGTCTGCCTCCAGGGATTACGG + Intergenic
1067551259 10:47238026-47238048 CAGTGTGCTCCCTGAGTTTGAGG + Intergenic
1073755230 10:106574286-106574308 CAGTTTGCCTTCTGGGATTTTGG + Exonic
1075209305 10:120477691-120477713 CAGTGAGCCCCTTGGGAGGAGGG + Intronic
1077367679 11:2167692-2167714 CAGTTTCCCCACTGGGATTTGGG + Intronic
1080770950 11:35340875-35340897 CAGTGTGCCCCCTGGGATTATGG + Intronic
1081994341 11:47353968-47353990 CAGTGAGCCCTCTGGGGTTGAGG + Intergenic
1084736486 11:71108718-71108740 CAGAGTGCCCCCGGGGATAGGGG - Intronic
1092148167 12:6229101-6229123 AAGTTTGCAGCCTGGGATTAGGG - Intronic
1092182152 12:6453238-6453260 CAGTGTGCCCCCTTGGAAATCGG - Exonic
1093644658 12:21571205-21571227 AAGTGTGCCCCATGGGAGGAGGG - Intronic
1101506530 12:105351942-105351964 CAGTGTGACACATGGGATGAGGG + Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1105739967 13:23313858-23313880 GATTGTGCCCACTGGGGTTAAGG - Intronic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113438556 13:110311221-110311243 CAGGCTGCCCCGTGGGATTTCGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1127862144 15:63003183-63003205 CAGTCTGCCCCCTGGAAGTCTGG + Intergenic
1129278301 15:74462061-74462083 CAATGTGCGACCTGGGATTAAGG + Intergenic
1132767141 16:1540091-1540113 CAGTGTGCCTCCAGGGATGCTGG + Intronic
1135980060 16:27140432-27140454 CAGTGTGGCCCCTGGGCATCTGG - Intergenic
1137668486 16:50265884-50265906 CAGTTTCCCCACTGGGATCATGG - Intronic
1138794173 16:59947523-59947545 CAGTGTGGCCACTGGAATCAGGG + Intergenic
1139342532 16:66277879-66277901 CAGCCTGCTCCCTGGGATCATGG + Intergenic
1140480295 16:75258833-75258855 GTGTGTGCCTCCTGGGCTTAGGG + Intronic
1146000352 17:29126895-29126917 CAGTGGGCCCCTTGGGATATAGG - Intronic
1149298621 17:55284251-55284273 CTGTGTGCTCCCTGGGATCCAGG + Intronic
1150462763 17:65366299-65366321 CAGGGTGCATCTTGGGATTATGG - Intergenic
1151324758 17:73372271-73372293 CAGTGTGCCCCATGGGAACCAGG - Intronic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1158126424 18:54104368-54104390 CAGTATGCCCTCAGGAATTAAGG + Intergenic
1162057373 19:8072658-8072680 CACTGTGCCCCCAGGGATGTGGG + Intronic
1162451784 19:10759468-10759490 GAATGGGCCCCCTGGGAGTACGG + Intronic
1163430211 19:17262851-17262873 GACTGTGCCCCCTGGGAATGGGG - Exonic
1163775049 19:19212739-19212761 CAGTGTGTTCCCTGGGATAAGGG - Intronic
1166100483 19:40568605-40568627 CAGTTTGCCCACTGGGCTAATGG + Intronic
1166528092 19:43526021-43526043 CAGTGCCCCACCTGGGTTTATGG + Intronic
1167854770 19:52228680-52228702 CAGTGTGACTGCTGGGATTTAGG - Exonic
1168524996 19:57081676-57081698 CAGTGGTCCCCCTGGCATCAAGG - Intergenic
928168019 2:28984818-28984840 TAGTGTGCTCCCAAGGATTAAGG - Intronic
928724619 2:34157573-34157595 CAGGGTGCCCACTTGGAATATGG - Intergenic
930308827 2:49712284-49712306 CAGTGTGCCCCCTTGGAGATGGG + Intergenic
933501675 2:83119844-83119866 CTGTGTGCCTGCTGGGATCAAGG - Intergenic
935943920 2:108269273-108269295 CAATGTGCCCCCTGGGTGGAAGG - Intergenic
940092460 2:149936285-149936307 TTGTGTGCTCCATGGGATTAAGG - Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941974837 2:171392084-171392106 CAGTGGCCCCTCTGGGATCAAGG - Exonic
948393124 2:237626872-237626894 CTGTCTGCCCCCTGAGATCAAGG - Intergenic
1170520569 20:17180401-17180423 AAGTGGGACCCCTGGGCTTAAGG - Intergenic
1178670940 21:34591276-34591298 CAGTGTGCCCTCTGGACATAAGG + Intronic
1179197201 21:39175690-39175712 CAGTGAGACCCCAGGGATTCAGG + Intronic
1182447184 22:30396840-30396862 AAGTGTGCCCACTGGGACTGAGG - Exonic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183342448 22:37289101-37289123 CAGTTTGCCCCCTGGTCTTCTGG + Intronic
1183591547 22:38782016-38782038 CAGTGTTCCCCCTTCGATTCAGG + Intronic
1184296772 22:43530029-43530051 CATTGGGCCCCATGGGATGAAGG + Intronic
951278882 3:20722579-20722601 CAATGTGCCTCTTGGGATAATGG + Intergenic
952449436 3:33417820-33417842 CTGTAAGCCCCCTGGGAGTATGG - Intronic
953037475 3:39225611-39225633 CAGTGTTCCCTCTTGGCTTATGG - Intergenic
953880335 3:46688034-46688056 CAGAGTGACACCTGGCATTAAGG - Intronic
956066555 3:65402764-65402786 CAGAGTGCCCACTGGGAGTGAGG + Intronic
964949239 3:162267353-162267375 AAGTGTTCCCTCTGGGATTTAGG + Intergenic
964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG + Intergenic
968639367 4:1704070-1704092 CAGTGTGCCCACTGTGTTTGGGG + Intronic
968725508 4:2246101-2246123 CAGTGTGCCACCTGTGAGAAGGG + Intergenic
969106505 4:4810763-4810785 CAGTGTCCCAGCTGGGATTGGGG + Intergenic
970163655 4:13214371-13214393 AAGTGTGGCCCCTGAGGTTAGGG - Intergenic
971485249 4:27153353-27153375 CATTGTTCCCCCAGGGATGAAGG + Intergenic
976686683 4:87821906-87821928 AGGTGTGCACGCTGGGATTATGG - Intronic
985514672 5:335413-335435 CAGGGTGTCCCCTGGGAGAAGGG + Intronic
985936436 5:3101328-3101350 CAGTGGCCCACCTGGGATGAAGG + Intergenic
987121595 5:14772999-14773021 CAGAGTTCTCCCTGGGATCAGGG + Intronic
988369822 5:30354143-30354165 AAATGTGCCCCCTAGGATTTTGG + Intergenic
989101697 5:37829344-37829366 CAGTGAGCTCACTGGGATTTGGG - Intronic
990650870 5:57898127-57898149 CAGTCTGCGCCATGGGATTTGGG + Intergenic
992949154 5:81839601-81839623 CAGTGTTCTACCTGGTATTAAGG - Intergenic
998367018 5:141638178-141638200 CAGGGCGCCTCCTGGGTTTAGGG - Exonic
1002103640 5:176869394-176869416 CCGAGTGCCCCCTGGGAGAAGGG + Intronic
1002417541 5:179128280-179128302 CCCTGTGCCCCCTGGGGTAATGG - Intronic
1003954798 6:11151868-11151890 AATAGTGCCCCCTGGGATTACGG + Intergenic
1005802858 6:29444932-29444954 GAGTGGGTCCCATGGGATTAGGG - Intronic
1005883876 6:30080217-30080239 CACTGAGGCCCCTGGGATTCTGG + Intergenic
1006595361 6:35189143-35189165 AAGTGTGTCTCCTGGGATTTGGG + Intergenic
1007739493 6:44002225-44002247 CATTGTGCACCGAGGGATTAGGG - Intronic
1012774567 6:103483702-103483724 GTGTGTGCCCCCTGGGATATGGG + Intergenic
1013451577 6:110286779-110286801 GATTGTGCCCACTCGGATTAAGG - Intronic
1018316502 6:162561993-162562015 AACTGTGCAGCCTGGGATTAGGG - Intronic
1023148895 7:37181140-37181162 AACTGTGACCCCTGGAATTATGG - Intronic
1027228916 7:76261105-76261127 CAATGTCCCCCCTGGCATTGTGG - Intronic
1034159633 7:148983324-148983346 CAGTGGCCCCCCCGGGATCAGGG - Intergenic
1039614154 8:38941611-38941633 CAGTGTCCCACCTGGAACTACGG - Intronic
1040547094 8:48407204-48407226 CAGTGTCCACACTGGGAGTAGGG - Intergenic
1041500386 8:58533416-58533438 CAGTATTCCCCATGGGACTATGG - Intergenic
1043998052 8:86843407-86843429 CAGTATGCCCCATGGGCTTGTGG + Intergenic
1045664788 8:104472542-104472564 CAGTGTGTCCCCTGAGAATCAGG - Intergenic
1045827192 8:106412294-106412316 CAGGATGCCTACTGGGATTAGGG - Intronic
1047170331 8:122486448-122486470 CAGTGGGCCCCCTGGCTTTCTGG + Intergenic
1047352490 8:124088941-124088963 AACTGTGCTGCCTGGGATTAGGG + Intronic
1049218497 8:141418270-141418292 CAGGGCGCCCCCTGTGATTTTGG - Intronic
1049278355 8:141731267-141731289 CTCTGTGCTCCCTGGGATTCAGG + Intergenic
1050142150 9:2527357-2527379 AAGTGTTCTCCCTGTGATTAAGG - Intergenic
1050577046 9:7008111-7008133 CACTGTACCGCCTGGGATTAGGG - Intronic
1052917307 9:33933249-33933271 CACTGGGTCCCCTGGGAGTAGGG - Intronic
1060933058 9:127500941-127500963 CAATGAGCCCCCAGGGGTTAGGG + Intronic
1061192423 9:129089486-129089508 CAGTCTGCCCTCTGGGCATAGGG - Exonic
1061678341 9:132230687-132230709 CAGTGTCCCCTCTGGGACTTGGG + Intronic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1189781331 X:44517010-44517032 CAGTGTCCCCTCAGAGATTAGGG - Intergenic
1191024131 X:55895142-55895164 CAGTGAGCCCACAGGGAGTAGGG - Intergenic
1192876077 X:75230804-75230826 CAGTGTGGCTACTGGGATTTAGG - Intergenic
1194538628 X:95141926-95141948 TACTGTGCCCCCTGGGGTGATGG - Intergenic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic
1199606808 X:149584947-149584969 CTCAGTGCCCCCTGGGATCAAGG + Intronic
1199632315 X:149784421-149784443 CTCAGTGCCCCCTGGGATCAAGG - Intronic
1199782923 X:151080070-151080092 CTGGGTGCCCCCTGGGATGAGGG + Intergenic