ID: 1080773453

View in Genome Browser
Species Human (GRCh38)
Location 11:35363884-35363906
Sequence GACACGGAGGTGTACAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080773445_1080773453 25 Left 1080773445 11:35363836-35363858 CCTTTTCCTCACTGATTGGTTCT 0: 1
1: 0
2: 1
3: 39
4: 394
Right 1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 234
1080773446_1080773453 19 Left 1080773446 11:35363842-35363864 CCTCACTGATTGGTTCTCATTCA 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080773453 Original CRISPR GACACGGAGGTGTACAAGGC AGG Intronic
900202027 1:1412286-1412308 GACACCGAGTTGTAGAAGGAAGG + Intergenic
900204749 1:1427165-1427187 GAGACGGAGGGGTGCAGGGCGGG - Intronic
902450384 1:16493068-16493090 GATAGGGAGGTGAACAAGGTAGG - Intergenic
904170270 1:28586940-28586962 GACACCGAGTTGTAGAAGGAGGG + Intergenic
904573125 1:31482904-31482926 GACACCGAGTTGTAGAAGGAAGG + Intergenic
905652777 1:39667656-39667678 GACACCGTGGTGGACATGGCAGG + Intronic
906498880 1:46325581-46325603 GACACCGAGTTGTAGAAGGAAGG + Intergenic
906499632 1:46332103-46332125 GACACCGAGTTGTAGAAGGAAGG + Intergenic
911909600 1:103616223-103616245 GACACTGAGTTGTAGAAGGAAGG + Intergenic
911911871 1:103647718-103647740 GACACTGAGTTGTAGAAGGAAGG + Intergenic
911912701 1:103655109-103655131 GACACCGAGTTGTAGAAGGAAGG + Intergenic
911915754 1:103696839-103696861 GACACCGAGTTGTAGAAGGAAGG - Intronic
911916583 1:103704230-103704252 GACACTGAGTTGTAGAAGGAAGG - Intronic
911919286 1:103741856-103741878 GACACTGAGTTGTAGAAGGAAGG + Intronic
911920113 1:103749247-103749269 GACACCGAGTTGTAGAAGGAAGG + Intronic
914510198 1:148325345-148325367 GACACGGAGTTGTAGAAGGAAGG + Intergenic
915164816 1:153942555-153942577 AACACGCTGGTGTACGAGGCAGG - Exonic
917117336 1:171615848-171615870 GACACTGAGTTGTAGAAGGAAGG - Intergenic
917838494 1:178959209-178959231 GACACAGAGCTGTAAAAGGCAGG + Intergenic
918932058 1:190866569-190866591 GTCACAGAGGTGTACAACTCTGG - Intergenic
919334665 1:196217043-196217065 GACACTGAGTTGTAGAAGGAAGG + Intergenic
921530059 1:216271097-216271119 GACACAGAGGTGTACCAAGTAGG - Intronic
1062993669 10:1845224-1845246 GAGACTGTGGTATACAAGGCAGG + Intergenic
1063665567 10:8058466-8058488 GACAAGGAGGAGGACGAGGCCGG - Exonic
1064125671 10:12658302-12658324 GAGACGAAGGTGTGCATGGCTGG + Intronic
1065478591 10:26168203-26168225 GATACAGAGATGAACAAGGCAGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067247907 10:44561562-44561584 GGCAGGGAGGTGAACAGGGCAGG - Intergenic
1070576568 10:77683433-77683455 GACACTGAGTTGTAGAAGGAAGG - Intergenic
1071288602 10:84172020-84172042 GACACTGAGTTGTAGAAGGCAGG + Intergenic
1072688733 10:97555497-97555519 GACACCGAGTTGTAGAAGGAAGG + Intronic
1072689347 10:97561359-97561381 GACACCGAGTTGTAGAAGGAAGG + Intronic
1073409928 10:103332086-103332108 GACACAGAGATGTATTAGGCCGG - Intronic
1076738932 10:132471601-132471623 GAAACGGAGGTCTGCCAGGCAGG + Intergenic
1077600207 11:3569429-3569451 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
1079201188 11:18378812-18378834 GACATGGAGGTGCAGAAAGCAGG - Intergenic
1079427454 11:20356996-20357018 GACATGGTGGTGTAGTAGGCAGG + Intergenic
1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG + Intronic
1083205197 11:61144561-61144583 GACACCCAGGTGCACAAGACAGG + Intronic
1083383284 11:62286508-62286530 GACACCGAGTTGTAGAAGGTAGG + Intergenic
1084256119 11:67944043-67944065 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
1084691001 11:70726518-70726540 GGAACGGAGGTGGACAAAGCTGG + Intronic
1086647783 11:89246123-89246145 GAGACCGAGGTATAAAAGGCAGG + Intronic
1086824658 11:91481728-91481750 GACACTGAGTTGTAGAAGGAGGG + Intergenic
1087629287 11:100631577-100631599 GACAGGAAGGTGTTCTAGGCAGG + Intergenic
1087990588 11:104742724-104742746 GACAGGGAGGCGTATAAGGGTGG + Intergenic
1089563461 11:119357429-119357451 AAGACGCAGGTGTGCAAGGCCGG - Intronic
1089961336 11:122619196-122619218 CACACGGTGGTATGCAAGGCGGG + Intergenic
1090880253 11:130826509-130826531 GACACAGCAGTGTACAAGACAGG + Intergenic
1091233709 11:134005046-134005068 GACAGGGAGGGGAACGAGGCAGG + Intergenic
1092041378 12:5388010-5388032 GACCCGCAGGTGAACAAGACAGG - Intergenic
1092426352 12:8378789-8378811 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG + Intronic
1096848047 12:54418715-54418737 GACACGGAGCTGGAGAAGTCTGG - Intronic
1098639111 12:72818343-72818365 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1098639709 12:72824333-72824355 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1099585915 12:84513520-84513542 GGCACGGTGGTGTACTTGGCAGG - Intergenic
1102050115 12:109856042-109856064 GACACAGAAATGGACAAGGCAGG - Intronic
1102074645 12:110050058-110050080 GACACCGAGTTGTAGAAGGAAGG - Intronic
1104927894 12:132323015-132323037 GACAAGGAGGTGGAGAAGCCGGG - Intronic
1105695107 13:22880706-22880728 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1105696048 13:22889792-22889814 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1106643624 13:31610168-31610190 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1114403040 14:22427541-22427563 GACACAGTGGTGCACAAGGCTGG + Intergenic
1118457335 14:65956913-65956935 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1121349963 14:93165538-93165560 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1121707912 14:96013296-96013318 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1122482552 14:102056430-102056452 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1124392449 15:29271809-29271831 GACACCGAGTTGCACAAGGAAGG - Intronic
1124530518 15:30501561-30501583 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1124768141 15:32506137-32506159 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1124863089 15:33461912-33461934 GATATGGTGGTGAACAAGGCAGG - Intronic
1130711625 15:86288017-86288039 AACAAGGAGGTGGAGAAGGCAGG - Intronic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1135205980 16:20484324-20484346 GGCACAGAGGTTGACAAGGCAGG + Intronic
1135212932 16:20539460-20539482 GGCACAGAGGTTGACAAGGCAGG - Intronic
1139100129 16:63756079-63756101 GACACGGAATTGTAGAAGGAAGG + Intergenic
1139405320 16:66713129-66713151 GACAAGGAGGTGAACAAGGTAGG - Intergenic
1139446216 16:67000338-67000360 GACAGGGAGGTGCCCAGGGCAGG + Intronic
1140588852 16:76327212-76327234 GACACTGAGGAATACAAGACAGG - Intronic
1141981104 16:87550970-87550992 CACACGGAGGTGGAGGAGGCGGG - Intergenic
1142269483 16:89081736-89081758 GAGACGGAGGTGGACGAGGCCGG - Intergenic
1142877021 17:2857339-2857361 GACAGGGAGGTGTGCCAGCCAGG + Intronic
1145960251 17:28883036-28883058 GGCAGGGAGGTGTGCAGGGCTGG - Intronic
1146763821 17:35501015-35501037 GACACTGAGTTGTAGAAGGAAGG - Intronic
1153705009 18:7736491-7736513 GACACCGAGTTGTAGAAGGAAGG + Intronic
1154294990 18:13139959-13139981 GACAATGAGGTGTGCAAGGAGGG - Intergenic
1156454648 18:37286126-37286148 GACAGGGTGGTCTACAGGGCAGG + Intronic
1158075150 18:53519493-53519515 GAGAGGGAGGTGCTCAAGGCTGG - Intronic
1159953216 18:74500700-74500722 GACACCGAGTTGTAGAAGGAAGG + Intronic
1160223162 18:76992022-76992044 GACACAGAGGTGAACAATGTCGG - Intronic
1160600262 18:80007221-80007243 GACACCGAGTTGTAGAAGGAAGG + Intronic
1162562741 19:11426868-11426890 CACACGGAGGTGGCCAAGGTAGG - Exonic
1163907751 19:20161854-20161876 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1163934684 19:20432155-20432177 GACACTGAGTTGTAGAAGGAAGG + Intergenic
1164895710 19:31875744-31875766 GACAGGGAGGTGTGCGAAGCCGG + Intergenic
1167910091 19:52694754-52694776 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1167915354 19:52735691-52735713 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1167935036 19:52898558-52898580 GACACTGAGTTGTAGAAGGAAGG + Intergenic
1167938163 19:52924066-52924088 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1168220775 19:54958739-54958761 GACACCGAGTTGTAGAAGGAAGG + Intronic
1168425241 19:56234864-56234886 GACACCGAGTTGTAGAAGGAAGG - Intronic
926367743 2:12148725-12148747 GATACGGAGGTGGAAAAGCCTGG + Intergenic
926679382 2:15652369-15652391 GGCAGGAAGGTGGACAAGGCAGG - Intergenic
926740532 2:16106838-16106860 GACACGGAGGTGAGAAAAGCAGG - Intergenic
927484521 2:23479389-23479411 GACACCGAGGTGGACAGCGCAGG - Intronic
930415598 2:51086639-51086661 GACACTGAGTTGTAGAAGGAAGG - Intergenic
930785987 2:55271776-55271798 GACACCGAGTTGTAGAAGGAAGG - Intergenic
931826745 2:66008245-66008267 CATACGGTGGTGTTCAAGGCAGG + Intergenic
931975300 2:67637633-67637655 CACACGGAGGTGAATATGGCTGG - Intergenic
933048563 2:77572136-77572158 AACACGAAGATGGACAAGGCTGG + Intronic
934141434 2:89051370-89051392 GACACCGAGTTGTAGAAGGAAGG - Intergenic
934227807 2:90149173-90149195 GACACCGAGTTGTAGAAGGAAGG + Intergenic
943621926 2:190158266-190158288 GACACTGAGTTGTATAAGGAAGG - Intronic
945292730 2:208141881-208141903 GAGACGCAGGTTTACAGGGCTGG + Intergenic
948462836 2:238138662-238138684 GACACGGAGGCCTGCAGGGCGGG - Intergenic
1169069223 20:2712232-2712254 GACAATGACCTGTACAAGGCAGG + Intronic
1169180725 20:3564430-3564452 GACACAGAGGTGGAAAAGACCGG + Intronic
1170009687 20:11708547-11708569 GACACAGAGTTGTAGAAGGAAGG - Intergenic
1170401254 20:15985800-15985822 GACACCGAGTTGTAGAAGGAAGG + Intronic
1171198870 20:23225195-23225217 AACACGGAGGAATACAAGGAGGG + Intergenic
1171199223 20:23227625-23227647 CAAATGGAAGTGTACAAGGCAGG + Intergenic
1171896667 20:30815079-30815101 GACACCGAGTTGTAGAAGGGAGG - Intergenic
1171963662 20:31514042-31514064 GACACTGAGGTGAACAATACAGG - Intergenic
1174407922 20:50314093-50314115 GACACGGAGGTGTCCAGGCTCGG - Intergenic
1174495842 20:50942054-50942076 GAAATGGAGGTGTATATGGCTGG - Exonic
1174537342 20:51261491-51261513 GACACTGAGTTGTAGAAGGAAGG + Intergenic
1174549808 20:51354258-51354280 GACACGGAGCTGTGCTTGGCGGG + Intergenic
1174945767 20:54983688-54983710 GACACTGAGTTGTAGAAGGAAGG + Intergenic
1174957640 20:55117511-55117533 GACATGGAGTTGTAGAAGGAAGG + Intergenic
1175208176 20:57327957-57327979 GACACAGCTGTGAACAAGGCAGG - Intergenic
1175850030 20:62085334-62085356 GTCACGGAGGATTTCAAGGCGGG + Intergenic
1177375985 21:20271313-20271335 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1179265439 21:39798574-39798596 GACACAGATGTGTACAACTCAGG - Intronic
1182808983 22:33099771-33099793 GGCACATAGGTGTACCAGGCAGG + Intergenic
1182984983 22:34707789-34707811 GAGACAGAGGTGCGCAAGGCAGG - Intergenic
1183469709 22:37998880-37998902 GAGACGGAGATGTCAAAGGCAGG + Intronic
950212226 3:11132246-11132268 GACACCGAGTTGTAGAAGGAAGG - Intergenic
950545677 3:13636650-13636672 GAGAGGGAGGTGATCAAGGCAGG - Intronic
954848296 3:53578611-53578633 GAGGCGGAGGTCTACAAGGAGGG + Intronic
956996426 3:74831261-74831283 GACACCGAGTTGTACAAGGAAGG - Intergenic
957117282 3:76042978-76043000 GACACCGAGTTGTAGAAGGAAGG - Intronic
957289944 3:78266994-78267016 GACACCGAGTTGTAGAAGGAAGG - Intergenic
957871181 3:86092242-86092264 GACACTGAGTTGTAGAAGGAAGG + Intergenic
958421518 3:93937080-93937102 GACACCGAGTTGTAGAAGGAAGG + Intronic
958790116 3:98642761-98642783 GACACCGAGTTGTAGAAGGAAGG + Intergenic
959060605 3:101612959-101612981 GACACCGAGTTGTAGAAGGAAGG + Intergenic
960801986 3:121549091-121549113 GACACCGAGTTGTAGAAGGAAGG - Intergenic
961260419 3:125597158-125597180 GACACCGAGTTGTAGAAGGAAGG - Intergenic
961283082 3:125778644-125778666 GACAGGGAAGTGTGCAAGGGTGG + Intergenic
962825152 3:139094575-139094597 GACACTGTGGGCTACAAGGCAGG - Intronic
964924892 3:161943846-161943868 GACACCGAGGTGTAGAAGGAAGG + Intergenic
964982912 3:162708952-162708974 GACACCGAGTTGTAGAAGGAAGG + Intergenic
967659682 3:192091447-192091469 GACACCGAGTTGTAGAAGGAAGG + Intergenic
968411040 4:390226-390248 GACACCGAGTTGTAGAAGGAAGG - Intergenic
968518207 4:1023611-1023633 GAGACGGAGGTGCACAGGGAGGG - Intronic
969014631 4:4095778-4095800 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
969739309 4:9012663-9012685 GACAGGGAAGTGTGCAAGGGTGG + Intergenic
969798490 4:9544176-9544198 GACAGGGAAGTGTGCAAGGGTGG + Intergenic
970124743 4:12796652-12796674 GACACAGAAGTGTACATAGCGGG - Intergenic
970620376 4:17811285-17811307 GTCGCGAAGGTGAACAAGGCTGG - Intronic
972275377 4:37552411-37552433 GACACTGAGTTGTAGAAGGAAGG - Intronic
974988364 4:69057283-69057305 GACACCGAGTTGTAGAAGGAAGG - Intronic
976989885 4:91353151-91353173 GACACTGAGTTGTAGAAGGAAGG + Intronic
976990499 4:91358989-91359011 GACACCGAGTTGTAGAAGGAAGG + Intronic
978264442 4:106805456-106805478 GACACTGAGTTGTAGAAGGAAGG - Intergenic
979052306 4:115950804-115950826 GACACCGAGTTGTAGAAGGAAGG - Intergenic
979052900 4:115956470-115956492 GACACCGAGTTGTAGAAGGAAGG - Intergenic
983208594 4:164935862-164935884 GACACCGAGTTGTAGAAGGAAGG + Intergenic
985444875 4:190016293-190016315 GACACCGAGTTGTAGAAGGAAGG + Intergenic
985835884 5:2271665-2271687 GAGACGGAGGTGGTCAGGGCAGG + Intergenic
987213152 5:15705384-15705406 GACACAGAGCTGTACAGGACAGG - Intronic
987855861 5:23420118-23420140 GACACTGAGTTGTAGAAGGAAGG + Intergenic
988287552 5:29239913-29239935 GACACCGAGTTGTAGAAGGAAGG + Intergenic
989163054 5:38409952-38409974 GCCACGGAGAAGGACAAGGCTGG - Intronic
989775819 5:45205992-45206014 GACACCGAGTTGTAGAAGGAAGG + Intergenic
989775884 5:45206546-45206568 GACACCGAGCTGTAGAAGGAAGG - Intergenic
992308946 5:75474352-75474374 GACACCGAGTTGTAGAAGGAAGG - Intronic
992989253 5:82267307-82267329 GACACCGAGTTGTAGAAGGAAGG + Intronic
1000604430 5:163313073-163313095 GACACTGAGTTGTAGAAGGAAGG + Intergenic
1000605090 5:163319077-163319099 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1004116278 6:12771036-12771058 GAGAGGGAGCTGGACAAGGCAGG + Intronic
1005472776 6:26178247-26178269 GACACCGAGTTGTAAAAGGAAGG - Intergenic
1005586884 6:27285529-27285551 GACACTGAGTTGTAGAAGGAAGG - Intergenic
1006026012 6:31147429-31147451 GACACTGAGGTACCCAAGGCAGG - Intronic
1006032345 6:31186324-31186346 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1006801544 6:36763052-36763074 GAAACGGATGTGTGCAAGGCTGG - Intronic
1007369056 6:41414179-41414201 GATACAGAGTTGAACAAGGCAGG - Intergenic
1007410071 6:41656485-41656507 GACAGGGAGGTGAGGAAGGCAGG - Intergenic
1009047090 6:58245910-58245932 CACACGGGGGTGTACACGGTGGG - Intergenic
1009357303 6:62766613-62766635 GACACTGAGTTGTAGAAGGAAGG - Intergenic
1015712542 6:136157898-136157920 GAGACGGAGCTGTAGATGGCAGG - Intronic
1017406878 6:154129045-154129067 GACACCGAGTTGTAGAAGGAAGG + Intronic
1018206328 6:161440448-161440470 GACACGGAGGTTGAGAAGCCTGG + Intronic
1018645542 6:165944407-165944429 GACAGGGAGGTGGACATGGTGGG + Intronic
1018773088 6:166989326-166989348 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1022243774 7:28537482-28537504 GACATGGAGGTGTACAAAGATGG + Intronic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1022495901 7:30853043-30853065 GGCAGGGAGGTGGATAAGGCAGG - Intronic
1022502772 7:30893037-30893059 GACAGGGTGGGGTACAGGGCCGG - Intergenic
1022606246 7:31817195-31817217 GACAAGGAGGTGGAGAAGGAAGG + Intronic
1030111493 7:106030626-106030648 GACACAGTGATGAACAAGGCAGG - Intronic
1030524741 7:110639541-110639563 GACAGGGAGGTGTGCAGGACAGG + Intergenic
1031742726 7:125455065-125455087 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1032782112 7:135171686-135171708 GACACGGAGCTGTAGAAGAAAGG - Intergenic
1034425907 7:151013874-151013896 GACATGGAGCTGGACGAGGCCGG + Exonic
1034900534 7:154905666-154905688 GACAAGGAAGGATACAAGGCCGG - Intergenic
1036556367 8:9863563-9863585 GCCTCAGGGGTGTACAAGGCTGG + Intergenic
1038089316 8:24235898-24235920 GACACTGAGTTGTAGAAGGAAGG - Intergenic
1038090105 8:24242838-24242860 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1039058562 8:33555697-33555719 GATACAGAGGTGGACAAGTCTGG - Intronic
1041464319 8:58143734-58143756 GACACGCAGGTGTGCATGGAAGG + Intronic
1041725936 8:61017396-61017418 GACACGGAGGTGCAAGAAGCCGG + Intergenic
1044142788 8:88675303-88675325 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1044645727 8:94441259-94441281 GACACCGAGTTGTAGAAGGAAGG - Intronic
1045799585 8:106087063-106087085 GACACCGAGTTGTAGAAGGAGGG + Intergenic
1048915472 8:139178730-139178752 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1049219467 8:141422353-141422375 GAGACGGAGGTGTGGCAGGCAGG + Intronic
1052661904 9:31444132-31444154 GACACTGAGTTGTAGAAGGAAGG - Intergenic
1053749296 9:41236399-41236421 GACACCGAGTTGTAGAAGGAGGG - Intergenic
1054254738 9:62801250-62801272 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1054336567 9:63814350-63814372 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1055315155 9:75027816-75027838 GACACGCGGGTGTGCAGGGCCGG + Intronic
1056373262 9:85980373-85980395 GACAGGCATGAGTACAAGGCTGG - Intronic
1057171226 9:92964457-92964479 GAGACGGATGTTTTCAAGGCAGG + Intronic
1062614747 9:137391281-137391303 GACACGGCGGTGAACAGGGCAGG - Intronic
1203376500 Un_KI270442v1:381763-381785 GACACCGAGTTGTAGAAGGAGGG + Intergenic
1186013384 X:5163333-5163355 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1188877055 X:35442986-35443008 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1189197982 X:39167648-39167670 GACACGCAGGTGTTCCAGTCAGG - Intergenic
1190639810 X:52473340-52473362 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1192075016 X:67985214-67985236 GACACCGAGCTGTAGAAGGAAGG - Intergenic
1192285057 X:69726818-69726840 GACAGGCAGGTGCACAAGCCTGG + Intronic
1193186036 X:78513907-78513929 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1193538848 X:82746185-82746207 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1194503518 X:94705774-94705796 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1195129431 X:101839176-101839198 GACACGGAGGTGAGTGAGGCCGG + Intronic
1195176807 X:102320653-102320675 GACACGGAGGTGAGTGAGGCCGG - Intronic
1195182057 X:102366440-102366462 GACACGGAGGTGAGTGAGGCCGG + Intronic
1196252070 X:113472973-113472995 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1196861818 X:120035838-120035860 GACACTGAGTTGTAGAAGGAAGG + Intergenic
1197114219 X:122813531-122813553 GACACCGAGTTGTAGAAGGAAGG + Intergenic
1199162880 X:144634814-144634836 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1200744464 Y:6891524-6891546 GACACGGAGTTGTAGAAGGAAGG - Intergenic
1201065551 Y:10091797-10091819 GACACCGAGTTGTAGAAGGAAGG - Intergenic
1201390666 Y:13493658-13493680 GACACGGAGTTGTAGAATGAAGG + Intergenic
1201696375 Y:16831774-16831796 GACACTGAGCTGTAGAAGGGAGG - Intergenic