ID: 1080773868

View in Genome Browser
Species Human (GRCh38)
Location 11:35367395-35367417
Sequence GACCCTCATGTGTCTAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080773865_1080773868 4 Left 1080773865 11:35367368-35367390 CCTTGGGGGAAATGCCTTCTGCA 0: 1
1: 1
2: 0
3: 20
4: 168
Right 1080773868 11:35367395-35367417 GACCCTCATGTGTCTAACACAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1080773864_1080773868 13 Left 1080773864 11:35367359-35367381 CCAGGGTGACCTTGGGGGAAATG 0: 1
1: 0
2: 0
3: 21
4: 193
Right 1080773868 11:35367395-35367417 GACCCTCATGTGTCTAACACAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1080773867_1080773868 -10 Left 1080773867 11:35367382-35367404 CCTTCTGCATCTGGACCCTCATG 0: 1
1: 0
2: 0
3: 11
4: 202
Right 1080773868 11:35367395-35367417 GACCCTCATGTGTCTAACACAGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080773868 Original CRISPR GACCCTCATGTGTCTAACAC AGG Intronic
902646821 1:17805252-17805274 GACCCTCCTCAGTCTAAAACAGG + Intronic
907632332 1:56095245-56095267 GCCCCCCTTGTGTCAAACACTGG - Intergenic
908297288 1:62725471-62725493 AACTCTCAATTGTCTAACACTGG + Intergenic
917014744 1:170517493-170517515 GTACATCCTGTGTCTAACACTGG - Intergenic
918111582 1:181459515-181459537 TGCCCTCTTGTGCCTAACACTGG + Intronic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
923110071 1:230883295-230883317 GACCATCATGAGGCAAACACAGG - Intergenic
1064117459 10:12591133-12591155 GACCCCTCTGTGTCTAACACGGG - Intronic
1077335688 11:2002885-2002907 GACACTCATGCGACTAACATCGG - Intergenic
1078476484 11:11634531-11634553 GTCAGTCATGTGTCCAACACTGG + Intergenic
1080773868 11:35367395-35367417 GACCCTCATGTGTCTAACACAGG + Intronic
1081619310 11:44609620-44609642 TACCCTCATGTGTGAGACACAGG + Intronic
1084425625 11:69083048-69083070 CACGATCATGTGTCTTACACGGG - Intronic
1085251923 11:75149648-75149670 GACCCTCATGGGTTTGACCCAGG - Intronic
1086405382 11:86494773-86494795 GACCCTCATTTGTCTCCCTCAGG + Intronic
1087016948 11:93563248-93563270 GACCTTAATGTGAGTAACACAGG + Intergenic
1087216278 11:95498633-95498655 GACCCACATGTGTTTAAAGCTGG + Intergenic
1202818672 11_KI270721v1_random:58067-58089 GACACTCATGCGACTAACATCGG - Intergenic
1092673137 12:10885868-10885890 GACCCTCATATGCCCAGCACAGG - Intronic
1092712960 12:11357137-11357159 GACCCTCATGTGCACAGCACAGG - Intronic
1092716752 12:11397107-11397129 GACCCTCATGTGCACAGCACAGG - Intronic
1094498052 12:31001606-31001628 GCCCTTCAAGTGGCTAACACTGG - Intergenic
1094677270 12:32633133-32633155 GACTCCTATGTGTCTGACACAGG + Intronic
1099050555 12:77777492-77777514 CACCCTGCTGTGTCTAACTCAGG - Intergenic
1104536104 12:129619699-129619721 GATCCTCATGTTTGAAACACTGG - Intronic
1106618717 13:31353964-31353986 GAGCATCAGGTGTCTAATACTGG + Intergenic
1109859847 13:68182967-68182989 GACACTCATTTTTATAACACAGG - Intergenic
1109890307 13:68603050-68603072 GAGCCTCAAGGGTCTAGCACTGG + Intergenic
1113201590 13:107872200-107872222 CACCCTCATTTGACTCACACCGG - Intergenic
1115173654 14:30537095-30537117 GACCCTCATGTATCAACTACTGG - Intergenic
1118188024 14:63555071-63555093 GACCAGAATGTGTCGAACACGGG - Intergenic
1121688936 14:95860929-95860951 GGCCCTTATGTGGCTAATACTGG - Intergenic
1125348038 15:38739773-38739795 GGCCACCATGTGTCTAACATGGG + Intergenic
1128599783 15:68986469-68986491 AAGCCTCATTTCTCTAACACAGG + Intronic
1129121228 15:73397968-73397990 GTCCCTCATGTGTAAAACAGGGG - Intergenic
1134429400 16:14187804-14187826 GACCCTCATGTCTCAAATTCAGG - Intronic
1139006881 16:62583828-62583850 GATCCTCAGGTGTCAATCACAGG - Intergenic
1139092749 16:63668603-63668625 GACTCTCATATGTCTAAGTCTGG + Intergenic
1139419911 16:66844004-66844026 GACCATCAAGTGTCCAAAACTGG - Intronic
1139593037 16:67943736-67943758 GACTCTCAGTTGTCTAACCCAGG - Exonic
1142823725 17:2493846-2493868 GACTCTCCTATGTCTACCACAGG + Intronic
1146894971 17:36534590-36534612 GACCCTCTTGTGTCTCACGAGGG - Intronic
931747014 2:65299540-65299562 GACCCTCAAGTGTCTCACCCCGG + Intergenic
1169693900 20:8365169-8365191 TATCCTCATCTGTCAAACACAGG - Intronic
1175282763 20:57815131-57815153 GTCCTTCATGAGTCTAACACAGG - Intergenic
1175469774 20:59219273-59219295 GACTCTCATCTGTCTCACAAAGG - Intronic
949840867 3:8318287-8318309 GACCCTTCTGTGTGTAACACAGG - Intergenic
950304043 3:11904805-11904827 GACCCTTCTGTGTCTCACACTGG + Intergenic
956870536 3:73412913-73412935 GACCCCCATGTGTCTCACCCTGG - Intronic
961412669 3:126734066-126734088 GACCCTTGTGTCTCTATCACAGG + Intronic
966476137 3:180348968-180348990 GACACTTATGTGTCAAGCACTGG + Intergenic
976480519 4:85538514-85538536 GACCATCCTGTGTCTTACAGAGG - Intronic
985727857 5:1525083-1525105 GACCCTTCTGTGTCTGAGACCGG + Intergenic
997331420 5:133065109-133065131 GCCCATTATGTGCCTAACACTGG + Intronic
1005397448 6:25397613-25397635 AACCCTCATGTGTCAAATAATGG - Intronic
1005891549 6:30144292-30144314 GACCTTCATGTTTCTGACATTGG - Intronic
1018172648 6:161154069-161154091 GACCCCCATGTGACTTCCACAGG - Intronic
1021153966 7:17186566-17186588 GACCCTCAAGTGTCCAGCCCTGG + Intergenic
1026189932 7:68116481-68116503 GACCCACACGCCTCTAACACTGG - Intergenic
1027814196 7:82948438-82948460 GACCCATATGTGTTAAACACTGG - Intronic
1033339716 7:140482465-140482487 GACCCCGATGTGCCCAACACAGG + Intergenic
1035078663 7:156198500-156198522 GACTCACCTGTGTTTAACACAGG + Intergenic
1040992268 8:53365326-53365348 GAGCCTCGTGTCTCAAACACAGG + Intergenic
1041539682 8:58969181-58969203 GACCCTCATGTGTTTCAAATTGG - Intronic
1042516386 8:69663353-69663375 GACCCTCATGTGACCATCATTGG + Intergenic
1044592061 8:93922906-93922928 GACCTTCATGTGGCCAATACTGG + Exonic
1046854474 8:119015503-119015525 TCCCCTCATGTTTCTAGCACAGG - Intronic
1056638040 9:88347597-88347619 GACCCTCATGTGCCTGTCATTGG - Intergenic
1060080515 9:120639625-120639647 GCTCCTCATTTGTCTAACAGAGG + Intronic
1061893256 9:133633796-133633818 GACTCTCCTGTGTCTGAGACAGG + Intergenic
1061974209 9:134060188-134060210 GATCCTCTTGTGTCTAAGGCAGG - Intronic
1185487444 X:493950-493972 GACCCTCATGTGTGGGACTCAGG - Intergenic
1185828790 X:3278554-3278576 CACCATCATGAGTCTCACACTGG - Intronic
1199495123 X:148444266-148444288 GACCCTCATTTATTTAACATGGG - Intergenic