ID: 1080776974

View in Genome Browser
Species Human (GRCh38)
Location 11:35395101-35395123
Sequence CCCTGAGTAGGGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080776965_1080776974 1 Left 1080776965 11:35395077-35395099 CCCCAATGAACAACAATGGGCTC 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 53
4: 344
1080776966_1080776974 0 Left 1080776966 11:35395078-35395100 CCCAATGAACAACAATGGGCTCT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 53
4: 344
1080776964_1080776974 2 Left 1080776964 11:35395076-35395098 CCCCCAATGAACAACAATGGGCT 0: 1
1: 0
2: 2
3: 4
4: 72
Right 1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 53
4: 344
1080776967_1080776974 -1 Left 1080776967 11:35395079-35395101 CCAATGAACAACAATGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 53
4: 344
1080776963_1080776974 3 Left 1080776963 11:35395075-35395097 CCCCCCAATGAACAACAATGGGC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 53
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080776974 Original CRISPR CCCTGAGTAGGGAGGGCAGT GGG Intronic
900463775 1:2813726-2813748 TCCTGAGTCGGGTGGGGAGTTGG + Intergenic
900531481 1:3155586-3155608 CCCGGAGGAGGGAGGGCCGCAGG + Intronic
901048936 1:6416507-6416529 GCCTGAGTCAGGAGGTCAGTGGG - Exonic
901318378 1:8324097-8324119 CTCTGAGTAGGGAAGGCACTGGG + Intronic
901631685 1:10651147-10651169 CCCCCTGGAGGGAGGGCAGTGGG + Intronic
901813473 1:11780687-11780709 CCCTGAGTTGGGAGAGAAGTGGG + Intronic
902148058 1:14420387-14420409 CCCTGAGTCGGGTGGGTACTTGG - Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902673005 1:17987979-17988001 CCCTGGGGAGGGAGAGCAGGCGG + Intergenic
902705536 1:18201632-18201654 CCCTTAGAAGGGAGAGCAGGTGG - Intronic
902781213 1:18706122-18706144 GAGTGAGGAGGGAGGGCAGTGGG - Intronic
902809215 1:18878870-18878892 CCATGAGTAGGGAGGGAGGAGGG - Intronic
903320879 1:22542554-22542576 GCCGGGGTAGGGAGGGCAGTGGG + Intergenic
903670408 1:25031985-25032007 CACCGAGTAGGATGGGCAGTGGG + Intergenic
903742406 1:25565857-25565879 CCCTGATGTGGGAGGGCTGTAGG - Intronic
904172682 1:28602453-28602475 CCCTGAGAAAGGATGGGAGTAGG - Intronic
904559049 1:31384615-31384637 CCTTGAGAAGGAAGGGCAGCTGG + Intergenic
904869528 1:33607934-33607956 CCCTGCGTAGGGAGGCCAGGGGG - Intronic
906114432 1:43346955-43346977 CCCTGCGTAGTGAGGTCTGTGGG - Intronic
906642825 1:47451697-47451719 CCCTGAGTAGGGAGTGAACCAGG - Intergenic
906729717 1:48070636-48070658 CTCTGACTAGGGTTGGCAGTGGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907228936 1:52976884-52976906 CCCAGAGTGGGGACGGCACTGGG - Intronic
907265338 1:53256322-53256344 CCCAGAGCAGGGAGGACAGCAGG - Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
910324880 1:85995574-85995596 CCCTGAGGAGGGAGGGGGGAAGG + Intronic
911269247 1:95780616-95780638 CCCAGAGCAGGGAGGACACTTGG - Intergenic
911320792 1:96411194-96411216 CTGTCAATAGGGAGGGCAGTTGG - Intergenic
912572083 1:110632123-110632145 ACCTGAGTGGGGAGTGCAGTGGG + Intergenic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
914826861 1:151143287-151143309 AACTGAGTAGGGAGGAGAGTTGG + Intronic
915249887 1:154580378-154580400 CCCTGAGTGGGCTGGGAAGTAGG - Intergenic
915634745 1:157178257-157178279 TCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915643107 1:157245252-157245274 CCCTGGGAAGGGAGGGCAATTGG + Intergenic
915650944 1:157310546-157310568 CCCTGGGAAGGGAGGGCAATTGG - Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
918064639 1:181090868-181090890 GCCTGGGTTGGGAGGGAAGTGGG + Intergenic
918161551 1:181905490-181905512 CCATGAGAAGGGAAGGCTGTTGG + Intergenic
920432712 1:205929005-205929027 CCCTAAGGAGGCAGGGGAGTGGG - Intronic
920803380 1:209209912-209209934 CCCTGAGTAAGGAAGGGACTGGG + Intergenic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922349091 1:224721281-224721303 CTCAGAATAAGGAGGGCAGTGGG - Intronic
922554457 1:226522114-226522136 CCCTGAATAGAGATGGGAGTAGG + Intergenic
922807560 1:228398493-228398515 CCCTGAGTAGGTGGGACTGTAGG - Intronic
924258473 1:242205770-242205792 CACTGAGCAGGGATGGCAGATGG + Intronic
924279519 1:242422203-242422225 CCATGAGGAGGGAGGGCAGGAGG + Intronic
1062918107 10:1257439-1257461 CCCTGAAGAGGAAGGGAAGTGGG - Intronic
1062924104 10:1301589-1301611 CCCTGAAGAGGGAGGGAAGGAGG - Intronic
1065837021 10:29667729-29667751 TCCTGAGTAGCTAGGACAGTAGG - Intronic
1066219014 10:33317336-33317358 CCAGTAGTAGGGAGGGGAGTTGG - Intronic
1067108381 10:43381057-43381079 GCCTAAGTAGGGAGGGAAATGGG - Intergenic
1067449195 10:46370995-46371017 CCCTGGACTGGGAGGGCAGTGGG + Intronic
1067588175 10:47489770-47489792 CCCTGGACTGGGAGGGCAGTGGG - Intronic
1067635299 10:47997861-47997883 CCCTGGACTGGGAGGGCAGTGGG - Intergenic
1067808966 10:49412404-49412426 TGCTGAGTAGGGTGAGCAGTGGG - Intergenic
1068659029 10:59604360-59604382 CCCTGAGTAAGGAGAGTAGCTGG + Intergenic
1068685755 10:59868568-59868590 ACCTCAGTAGGGAGGGCACCAGG - Intronic
1069560872 10:69428416-69428438 CTCAGTGGAGGGAGGGCAGTTGG - Intergenic
1069810033 10:71152138-71152160 CCCTGAGGTGGGAGGGGTGTGGG + Intergenic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071609828 10:87022209-87022231 CCCTGGACTGGGAGGGCAGTGGG + Intronic
1072219191 10:93313556-93313578 CCCTGAGCAGAGAGGTCATTTGG + Intronic
1074078373 10:110149607-110149629 TGCTGAGAAGGGAGGGGAGTAGG - Intergenic
1074126158 10:110530388-110530410 CCCTGAGTAGGGAGCCCCGTGGG + Intergenic
1074298782 10:112214570-112214592 CCCTGAGTAGGGAATACAGTGGG + Intronic
1075343944 10:121668687-121668709 CCCTAAGAAGGGAGGCCAGGGGG + Intergenic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076883136 10:133249240-133249262 CCCTGAGTGGGGAGGGGCGTGGG + Intergenic
1077473591 11:2776201-2776223 CCCTGCAGAGGGAGGGCAGCTGG + Intronic
1077488905 11:2851493-2851515 TCCTGAGTAGGGAGGGGGGCTGG - Intergenic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078146081 11:8722654-8722676 ACCTGACTAGGGAGGCCAGAGGG - Intronic
1078287345 11:9970491-9970513 CCCTAAGAAGTGATGGCAGTTGG - Intronic
1078461871 11:11520615-11520637 CGCTGAGTAGGGAGAGCTCTGGG + Intronic
1078672445 11:13377113-13377135 GCCTGAGAAGGGAGCCCAGTGGG - Intronic
1078682546 11:13491075-13491097 CCCTTAGTTGGGAGGGAAGATGG - Intergenic
1078713311 11:13816009-13816031 CCTTGAGTAGGGAGGGAGGTGGG + Intergenic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080640544 11:34155899-34155921 CCCTGCATGGGGAGGGCAGAGGG - Intronic
1080643003 11:34168789-34168811 CCCTGGGTTAGGTGGGCAGTTGG + Intronic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1083305138 11:61758111-61758133 CCCTGGGTGGGGAGTACAGTTGG + Intronic
1084069290 11:66723781-66723803 CCCTGAGTAAAGAGTGCTGTGGG + Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1087727336 11:101736940-101736962 CCTATAGTAGGGAAGGCAGTGGG + Intronic
1088499912 11:110473100-110473122 TCCTGAGTAGGTGGGGCAGGTGG + Intergenic
1088818211 11:113435532-113435554 CCCTGAGAAGGGAACACAGTGGG + Intronic
1089607267 11:119648698-119648720 GCCTGTTTAGGGAGGGCTGTGGG + Intronic
1091405992 12:209911-209933 CCCCGAGGAGGGAGAGAAGTTGG - Exonic
1091791470 12:3274467-3274489 CCAGGGGCAGGGAGGGCAGTGGG + Intronic
1091852795 12:3713757-3713779 CCCTGAGAAGGAAATGCAGTAGG + Intronic
1095431013 12:42134605-42134627 GTCTGAGTAGGGAGGGAAATGGG - Intronic
1096077120 12:48812869-48812891 CCCAGAGTCTGGAGCGCAGTAGG + Intergenic
1096407422 12:51354108-51354130 CCCAAAGTAGGGAAGGCAGCTGG - Exonic
1096557325 12:52411426-52411448 TCCAGAGTAGGGGGTGCAGTAGG - Intergenic
1097152176 12:56987209-56987231 CCCTGACAGGGGAGGGCAGAGGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1100406250 12:94275134-94275156 TTCTGAGTAGGGAGGACAGTGGG - Intronic
1100772471 12:97938578-97938600 CCCAGAACAGGGAGGGCAGTTGG - Intergenic
1100831272 12:98518414-98518436 CCCTGAGTAGCAAGGGCAACGGG + Intronic
1101577733 12:106013602-106013624 CAATGAGTAGGGAGGACAGGGGG + Intergenic
1102703141 12:114857567-114857589 GCCTGAGGATGGAGGGCAGGAGG - Intergenic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1103737757 12:123071151-123071173 TCTTGAGTAGGGTGGGCAGAGGG + Intronic
1104855003 12:131897390-131897412 GCCTGAGAACGGAGGGCAGCGGG - Intronic
1104939165 12:132386819-132386841 GGCTGAGAAGGGAGGGCCGTGGG - Intergenic
1105010960 12:132756406-132756428 CCCTGAGTAGCTGGGGCTGTAGG - Intronic
1105043987 12:132986572-132986594 CCCTGACTCGGGAGAGCAGGAGG - Exonic
1106179967 13:27362109-27362131 TGAGGAGTAGGGAGGGCAGTGGG + Intergenic
1108243537 13:48492303-48492325 CCCTTAGTAGGTGGAGCAGTGGG - Intronic
1108489897 13:50971100-50971122 GCCTGAGTAGTGCTGGCAGTGGG - Intronic
1109416363 13:62046432-62046454 CCCTGAGTCAGGTGGGCACTTGG - Intergenic
1110888161 13:80664863-80664885 CTTGGAGTAGGGAGGACAGTGGG + Intergenic
1112054094 13:95674478-95674500 CCCTGAGTAGCTAGGGCAACAGG + Intergenic
1112490810 13:99861653-99861675 CCCTTTGAAGGGGGGGCAGTGGG + Intronic
1112582525 13:100688727-100688749 CTCTGAGTAGGGAATGCAGTAGG - Intergenic
1113619171 13:111701341-111701363 CCCTGAGGACGGAAGGCAGGGGG + Intergenic
1113624700 13:111786602-111786624 CCCTGAGGACGGAAGGCAGGGGG + Intergenic
1116437693 14:44912622-44912644 TCCTGAGTGGGGTGGGCACTTGG + Intergenic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1117199512 14:53373844-53373866 CCCTGACTAGGGTGGTAAGTAGG - Intergenic
1117222946 14:53624701-53624723 TTCGGAGTAAGGAGGGCAGTAGG + Intergenic
1118324340 14:64771213-64771235 CCCTGGGCAGGGAGGCCAGGAGG - Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1120118404 14:80648186-80648208 CTCTGAGTCAGGAGAGCAGTTGG + Intronic
1121367066 14:93322997-93323019 ACCTGAGTAGCTAGGGCAGCAGG - Intronic
1125433913 15:39625836-39625858 CCCGGAGTAGGGGGTGGAGTAGG - Intronic
1126906926 15:53377961-53377983 TCCTTAATAGGGTGGGCAGTGGG - Intergenic
1127259789 15:57319533-57319555 CCCTGCGGAGGGAGGGAAGGAGG - Intergenic
1128142268 15:65310541-65310563 CCCCCAGTAGGGAGGGAAGAAGG - Intergenic
1130047047 15:80453696-80453718 CCATCAGTAGGGAGGGCAGTGGG - Intronic
1131837715 15:96407989-96408011 CCCTGAGAAGGGAGGGTGGCGGG + Intergenic
1132463495 16:67054-67076 CCCTGTGGAGGGAGGGCTGGGGG - Intronic
1132843360 16:1989349-1989371 CCAGGAGTAGGGAGGGCATTGGG + Intergenic
1132871555 16:2117754-2117776 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1134520974 16:14919141-14919163 CCCTGGGGAGGAAGGGGAGTGGG - Intronic
1134550598 16:15136832-15136854 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1134708650 16:16317792-16317814 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134715863 16:16357825-16357847 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134950954 16:18350853-18350875 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1134958893 16:18394334-18394356 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1136690521 16:32025108-32025130 CCCTGACTTGGGAGGGGAGGGGG - Intergenic
1136791108 16:32968668-32968690 CCCTGACTTGGGAGGGGAGGGGG - Intergenic
1136878706 16:33885264-33885286 CCCTGACTTGGGAGGGGAGGGGG + Intergenic
1137407153 16:48198107-48198129 CCGTGGGTAGTGAGGGCAGTGGG + Intronic
1138169390 16:54834639-54834661 CACTGAATAGGGAAGGCTGTAGG - Intergenic
1139639394 16:68280097-68280119 CCTTGAGTAGAGGCGGCAGTGGG + Intronic
1139708784 16:68760823-68760845 CCCAGAGTGGGGAGGCCAGGGGG + Intronic
1141343919 16:83228069-83228091 CCGTGAGAAGGGAGGCCAGATGG + Intronic
1141766695 16:86063786-86063808 GCCTGAGCAGGGAGGGTAGAGGG + Intergenic
1203093316 16_KI270728v1_random:1230129-1230151 CCCTGACTTGGGAGGGGAGGGGG - Intergenic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142960614 17:3550282-3550304 CCTTGAGTAGGTAGGGAGGTAGG - Intronic
1143665993 17:8360975-8360997 CACTGAGAAGGAAGGGCAGTGGG - Intergenic
1144698764 17:17323099-17323121 CCCTGTGAAGGCAGGGCAGGTGG + Intronic
1144771450 17:17761862-17761884 CACTGAGGAGCGAGGGCAGGTGG + Intronic
1146932989 17:36791304-36791326 CCCAAAGCAGGGAGGGCAGCAGG - Intergenic
1147153380 17:38531244-38531266 CCCTGACTTGGGAGGGGAGGGGG - Exonic
1147427001 17:40350682-40350704 CCCTTTGTGGGGAGGGCAGTGGG + Intronic
1148233960 17:45955165-45955187 CCCTCAGGAGGGAAGGCAGCTGG - Intronic
1148520885 17:48274045-48274067 TCCTGAGTAGGTAGGTCAATAGG + Intronic
1150277859 17:63911223-63911245 CCCTGAGTGGTGCGGGGAGTCGG + Intronic
1150381748 17:64726238-64726260 CCCATCTTAGGGAGGGCAGTCGG + Intergenic
1150649026 17:66997915-66997937 CCCTGAGAAGGAAGGGAAGGAGG + Intronic
1150774518 17:68068652-68068674 CCCACCTTAGGGAGGGCAGTCGG - Intergenic
1151674904 17:75592337-75592359 CCCAGAGTAGGAAGGGCAGAGGG + Intergenic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152553112 17:81039658-81039680 CCGTTAGATGGGAGGGCAGTGGG + Intronic
1152571906 17:81124632-81124654 CCATGAGTAGTGAGGTCAGGGGG - Intronic
1152578785 17:81156945-81156967 CCCTGTGTCGGGAGGCCTGTGGG - Intronic
1152618003 17:81346526-81346548 GCCTGAGTGGGGAGGGAGGTGGG + Intergenic
1152642764 17:81456059-81456081 CCCTACGTGGGGTGGGCAGTTGG + Intronic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1153755417 18:8277921-8277943 ACATGAGTAGGGAGAGAAGTGGG + Intronic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155085782 18:22456625-22456647 CCCTGAGTGGAGAGGGCCTTTGG + Intergenic
1157203054 18:45675636-45675658 TCCTGAGTAGGTGGGGCTGTAGG + Intronic
1157313707 18:46571344-46571366 TCCTGAGTAGCTAGGGCAATAGG - Intronic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158231327 18:55258954-55258976 CACAGAATAGAGAGGGCAGTGGG - Intronic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1159899901 18:74036361-74036383 CCCAGAGTAGGGTGGTCAGCTGG - Intergenic
1160538486 18:79607799-79607821 CCAGCAGTGGGGAGGGCAGTGGG - Intergenic
1160802463 19:976741-976763 CCCTGAGTAGGGAGGGAGAGAGG - Intergenic
1161296995 19:3525196-3525218 CGCAGCGTTGGGAGGGCAGTTGG + Intronic
1161303751 19:3555994-3556016 CCCTGATTAGAGAGGGCTGTTGG - Intronic
1161513800 19:4685469-4685491 CCCTGTGTAGTCAGGGCAGGCGG + Intronic
1161768010 19:6217419-6217441 CCCAGAGTGGGGAGGGCCCTGGG - Intronic
1162950108 19:14066369-14066391 CCCTGAGGTGGGAATGCAGTTGG + Intergenic
1163159107 19:15454326-15454348 CCCAGAGTAGGGAGGCAAGAAGG - Intronic
1164649591 19:29882392-29882414 CCCTGAGAAGTGGGAGCAGTGGG + Intergenic
1164830234 19:31314468-31314490 CCCTGAGAAGGTTGGGCAGAAGG - Intronic
1165752394 19:38268194-38268216 CTCTGAGTAGTGAGGGCAGGTGG + Intronic
1166091084 19:40509583-40509605 CCCTGAGTGCTGACGGCAGTTGG + Intronic
1166844561 19:45718692-45718714 CCCAGAGTAGGCAGGGAAGAGGG - Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
926700428 2:15799888-15799910 CCGGGAGCAGGGAGGGCACTTGG - Intergenic
927721744 2:25387569-25387591 CCCTAGGTAGAGAGGGCAGAGGG - Intronic
928280067 2:29938143-29938165 ACCTGAGAAGGGAGGGCAGGGGG + Intergenic
928454031 2:31403283-31403305 CTCTGAATAAGGAGGCCAGTGGG - Intronic
929554437 2:42916573-42916595 GGCTGAGTAGGGAGGGCAATTGG + Intergenic
929779137 2:44946542-44946564 GCCTGAGTGGGGAAGGCAGGAGG + Intergenic
932750249 2:74366920-74366942 TCCTGAGTAGGGTGGGCAGGAGG - Exonic
933104984 2:78313393-78313415 TCCTGAGTAGGTAGGACAATGGG - Intergenic
934576822 2:95407169-95407191 CAGTGACTAGGGAGGGCAGTGGG - Intronic
934614707 2:95763946-95763968 CCCTGTTCCGGGAGGGCAGTAGG + Intergenic
934639042 2:96015337-96015359 CAGTGACTAGGGAGGGCAGTGGG - Intergenic
934646197 2:96060549-96060571 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
934753542 2:96809712-96809734 CCCTGGATAGGGGGGGCAGTGGG + Exonic
934794606 2:97090075-97090097 CAGTGACTAGGGAGGGCAGTGGG + Intronic
934839600 2:97616632-97616654 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
936057515 2:109272075-109272097 CCCTGAGTGGTGGGGGCAGGAGG - Intronic
936667542 2:114613979-114614001 CCCAGGGGAGGGAGGGCATTAGG + Intronic
937792469 2:125977169-125977191 ACTAGAGTAGGGAGAGCAGTAGG + Intergenic
941721957 2:168821777-168821799 CCCTGAGGCAGGATGGCAGTTGG + Intronic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
944844472 2:203655097-203655119 CCCTGAGGAGGCAGCACAGTGGG + Intergenic
945731424 2:213541179-213541201 GTCTGAGTAGTGAGAGCAGTAGG + Intronic
946158188 2:217820584-217820606 CCCAGGCTAGGGAGGGCAGTGGG + Intronic
946164444 2:217855402-217855424 ACCTGAGTCTGGAGGACAGTAGG - Intronic
946961463 2:224989811-224989833 CCCTGAGTAGAGGTAGCAGTAGG - Intronic
948246972 2:236494894-236494916 GCCTGAGGAGAGAGGGCAGTAGG + Intronic
948426074 2:237887157-237887179 TCCTGTGTGGGGAGGGCAGTGGG + Intronic
948476941 2:238226492-238226514 CCGAGAGTGGGGAGGGCGGTGGG + Intronic
948843514 2:240672101-240672123 CCCTGAGCAGGGAGGGGAGGTGG + Intergenic
948887227 2:240890365-240890387 CCCTGAATACGGAGGGATGTAGG + Intronic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1172146560 20:32762171-32762193 CCCGGGGTTGGGAGGGCAGGGGG + Intergenic
1173151247 20:40568149-40568171 CCCTACGTAGGGAGTGCAGCTGG - Intergenic
1173461042 20:43243565-43243587 GTTTGAGCAGGGAGGGCAGTGGG - Intergenic
1173576918 20:44118241-44118263 CTCTGAGCAGGGAAGACAGTTGG - Intronic
1174339430 20:49886731-49886753 CCCTGAGCAGGGAGGAAAGGCGG - Exonic
1175138329 20:56841569-56841591 CCCTGGGAAGTGAGGGCAGCAGG - Intergenic
1175569129 20:60005931-60005953 CCCTAAGCAGGGAGGGAACTTGG - Intronic
1175593402 20:60211809-60211831 CACTGTGTTGGGAGAGCAGTGGG + Intergenic
1175634508 20:60569317-60569339 CCCAGTGTAGGGAAGGCTGTGGG + Intergenic
1176377523 21:6093898-6093920 CCCTGAGCAGGGAGGCCGGCAGG - Intergenic
1177374999 21:20258555-20258577 TCCTGAGCAGGGAGGGCACAAGG + Intergenic
1177669559 21:24208579-24208601 TCCTGAGTAGGGTGGGGACTTGG - Intergenic
1178387186 21:32162300-32162322 CCTGGAGTAGGAAGTGCAGTTGG - Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179431141 21:41322038-41322060 CCCTGAGTAGGATGGGTACTGGG - Intronic
1179745952 21:43444346-43444368 CCCTGAGCAGGGAGGCCGGCAGG + Intergenic
1180012174 21:45058520-45058542 CGCAGAGTGGGGAGGGGAGTGGG + Intergenic
1180702847 22:17791070-17791092 CACTGAGGAGGCAGGGCAGGAGG + Exonic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1183432886 22:37776143-37776165 CCCTGAGGAGGGATGGGAGGGGG - Exonic
1183433977 22:37782811-37782833 CCCTAGGTAGGGAGGGGATTTGG - Intergenic
1183532229 22:38364684-38364706 ACTTGAGTGGGGAGGGCAGGAGG + Intronic
1183662771 22:39231204-39231226 CCCTGAATAGGGAGAGCTTTGGG + Intronic
1184324376 22:43771911-43771933 CCCTGAGTAAGCATGGCAGGCGG + Intronic
1184371745 22:44086815-44086837 CTCTGAGTACGGATGGAAGTTGG + Intronic
1184781054 22:46649824-46649846 CCCTGAGCAGGGAGGGCCACGGG + Intronic
1185159524 22:49214836-49214858 CCCAAAGTGCGGAGGGCAGTGGG - Intergenic
1185184099 22:49382267-49382289 TCCTGAGTTAGGAGGGAAGTGGG + Intergenic
1185339924 22:50286674-50286696 CCCTGAGTTTTGGGGGCAGTGGG - Intronic
950115950 3:10450476-10450498 ACCTGAGTGGGGAGGGATGTGGG - Intronic
950445266 3:13033807-13033829 CCCAGCCTGGGGAGGGCAGTCGG + Intronic
950524860 3:13517693-13517715 CCTTGAGTTGGAAGGGCAGCAGG - Intergenic
951539835 3:23772041-23772063 CCCAGAGGAGGGTGGTCAGTGGG + Intergenic
952882194 3:37991810-37991832 CCCTGAGGAAAGAGGGCAGGAGG + Intronic
953494963 3:43377983-43378005 CCATGAGTCGGGACTGCAGTGGG - Intronic
953785989 3:45911624-45911646 CCCTGAGTCAGGAGGACAGGGGG + Intronic
954129367 3:48552287-48552309 CCCTGAGTCCCAAGGGCAGTCGG - Intronic
954304049 3:49716305-49716327 CCTTCTGTAGAGAGGGCAGTGGG + Intronic
954407157 3:50351607-50351629 TCCTGGGGAGGAAGGGCAGTGGG + Intronic
954760377 3:52869532-52869554 CCAGGAGAAGGGAGGGCACTTGG - Intronic
955791331 3:62591471-62591493 CCCTGAGGAGGGAGAGAATTTGG + Intronic
956058379 3:65324773-65324795 TCCTGAGTAGGGAGGGCTCCTGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957034908 3:75284991-75285013 GCCTGTGCAAGGAGGGCAGTGGG - Intergenic
957271223 3:78032651-78032673 GCCTAAGCAGGGAGGGCAGTGGG - Intergenic
961105433 3:124236950-124236972 CCCTCAGGAGGCAGGGCAGCAGG - Intronic
961304684 3:125949864-125949886 ACCTGTGCAAGGAGGGCAGTGGG + Intergenic
961433885 3:126902999-126903021 CCCTGCGAAGGGAGGTCAGGAGG + Intronic
961954299 3:130785436-130785458 CTCTGAGGAGGTAGGGCAGGTGG - Intergenic
963850359 3:150204847-150204869 CTCAGAGTAGGAAGGGCAGTTGG - Intergenic
964110681 3:153084191-153084213 CCCAGAGTAGTTAGGGCAGGAGG + Intergenic
964129359 3:153269175-153269197 TCCTGAGTCGGGAGGGGACTTGG + Intergenic
964385539 3:156143696-156143718 CTCTGAGTAGGGAGGTGATTTGG + Intronic
964413956 3:156428186-156428208 CCCACATTAGGGAGGGCAATCGG - Intronic
966144481 3:176794270-176794292 TCCCCAGTAGGGAGGGCAGTGGG + Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
966911071 3:184560661-184560683 CCCTGAGGAGGGAGAGAAGCTGG - Intronic
968575985 4:1366421-1366443 GCCTGAGTATGGTGAGCAGTGGG + Exonic
968602521 4:1517072-1517094 CCCTGAGGAGGGGTGGCAGAGGG - Intergenic
968647932 4:1749291-1749313 CCTTGGGGAGGGGGGGCAGTGGG - Intergenic
968979227 4:3837634-3837656 CCCAGAGTAGGGAGGGGCATGGG + Intergenic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
972461521 4:39308161-39308183 CCCTGAGTGGCAAGGGCACTAGG - Intronic
976016324 4:80559831-80559853 CCCTCAGTAGTGAGGGGTGTGGG - Intronic
976337272 4:83904891-83904913 CCCTGAGTAGATGGGACAGTAGG + Intergenic
981219756 4:142217762-142217784 CCCAAATTAGAGAGGGCAGTGGG - Intronic
981730278 4:147889709-147889731 TCCTGTGTTGGGAGGGCAGCTGG + Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983102238 4:163639017-163639039 CCCAGAGACTGGAGGGCAGTGGG + Intronic
985070777 4:186164884-186164906 CCATGTGTAGGGAGAGCAATTGG - Intronic
985789196 5:1916222-1916244 CCCGGAGCAGGGAGGGCTGTGGG - Intergenic
990819061 5:59817047-59817069 CCCAGAGTGGGGAGAGCAGATGG - Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
994451111 5:99945501-99945523 CCCTGAGTGGGGCGGGCGGGCGG - Intergenic
997778060 5:136629281-136629303 CCCTGAGTAAGTAGGTCAGGAGG - Intergenic
998227742 5:140339936-140339958 CCCTGAGTAGCAAGGGCAGGAGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999495135 5:152089369-152089391 CCCTGATGAGGGAGTGGAGTGGG - Intergenic
999824904 5:155264623-155264645 CCCAGAGCAGGGAAAGCAGTAGG + Intergenic
1001751679 5:174136270-174136292 CCCTGGGCTGGGTGGGCAGTAGG - Intronic
1002586441 5:180251849-180251871 CCCAGAGTTGAGCGGGCAGTGGG - Intronic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1002721188 5:181262082-181262104 CCCTGGGGAGGGAGGGCTGGGGG + Intergenic
1002823966 6:755824-755846 CCCAGAGAAGGGAGCCCAGTGGG - Intergenic
1003216582 6:4118816-4118838 CCCTGAGTTTGGAGGCCACTCGG - Intronic
1003383475 6:5646399-5646421 ACCTGTGCAGTGAGGGCAGTGGG + Intronic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1004250691 6:14020930-14020952 CGCTGAGTAGGAATGTCAGTTGG - Intergenic
1004904386 6:20222849-20222871 CCTTGAGTACGTGGGGCAGTAGG - Intergenic
1005470681 6:26159412-26159434 CCCTGAGTACGGAGGACTGGAGG + Intronic
1005616337 6:27576842-27576864 CCTTCAGTAGGCAGGGCAGCAGG + Intergenic
1006189446 6:32198654-32198676 CCCTGAGGAGGGAGAGGAGGTGG - Exonic
1006392079 6:33764398-33764420 CCCAGGCTGGGGAGGGCAGTGGG - Intergenic
1007203567 6:40131333-40131355 CCCTCTGCAGGAAGGGCAGTGGG - Intergenic
1008341750 6:50374112-50374134 CCCAGAGGAGGGAGGGAAGCAGG - Intergenic
1011078419 6:83462878-83462900 CTCTTAGTTGGGAGGGCAGGAGG + Intergenic
1014437243 6:121434674-121434696 CCCTGAAGAGGGAGAGCATTTGG + Intergenic
1017017918 6:150116457-150116479 CCATGAATGGGGAAGGCAGTTGG - Intergenic
1018101327 6:160443374-160443396 CCCAGAGCAGGCAGGGCAGTGGG + Intronic
1018721102 6:166573106-166573128 CCCGGTGCAGGGAGGGCAGGAGG + Intronic
1018984890 6:168628935-168628957 CCCTGAGAGGGAAGGGCAGGGGG + Intronic
1019276841 7:180214-180236 CCCTGAGGAGGGAGGGAGGCAGG + Intergenic
1019384456 7:746684-746706 CCCTGGGCAGGGTGGGCAGGGGG - Intronic
1019485966 7:1289286-1289308 CCCTGAGTCGGGAGAGCAGGCGG + Intergenic
1021193660 7:17650464-17650486 ACCTGAATAGGGAGTGAAGTAGG - Intergenic
1021784247 7:24136520-24136542 CCCTCAGTGGGGAGGGGAGGTGG - Intergenic
1022728877 7:33004468-33004490 TCCTGAGCAGAGAGGGCAGCCGG - Intronic
1023464788 7:40442251-40442273 CCCTGAGCAAGGAGGGCTCTTGG + Intronic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1028569656 7:92272628-92272650 CTCGGAGTAGGGAGTGCAATAGG + Intronic
1029159384 7:98540931-98540953 CAGGGAGTAGGGAGGGCAGGAGG + Intergenic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1030355129 7:108533438-108533460 CCCTAATTAGGGAGAGCTGTTGG + Intronic
1033256637 7:139807083-139807105 CCCACAGCAGGGAGGGCAGTTGG - Intronic
1033320160 7:140332059-140332081 CCCTGAGTAGCGAGGGCTACAGG - Intronic
1033390625 7:140924526-140924548 CCCGGAGTCGGGAGGGCGGCAGG + Intronic
1033653205 7:143357146-143357168 CAGTGAGTAGGGAGGACAATGGG + Intronic
1034400020 7:150856192-150856214 CCCTGAGTAAGGAAGGCTGCAGG + Intronic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039601463 8:38841929-38841951 CCCTGAGCTGGGAAGGCATTAGG - Intronic
1043322072 8:78999926-78999948 CCCTAAGAAGAGGGGGCAGTGGG - Intergenic
1044665516 8:94630579-94630601 CACAGAGAAGGAAGGGCAGTAGG - Intergenic
1045034652 8:98167695-98167717 CCCTAAGTCTGGAGGGCATTGGG + Intergenic
1045246141 8:100443146-100443168 CCCTGAGAAGGGTGGGGAGGAGG + Intergenic
1046190617 8:110790084-110790106 CCCTGAGCAAGGAGGGGATTAGG + Intergenic
1046694255 8:117320877-117320899 ACCTGAGTGGGGAGGGTAGAAGG + Intergenic
1047431825 8:124799500-124799522 GCTTGAGTAAGGAGGGCATTTGG - Intergenic
1048962615 8:139593316-139593338 CCCTGAGCAAGGAGGACACTTGG + Intergenic
1049004191 8:139844516-139844538 CCCTGTGCAGGGCGGGCAGTGGG + Intronic
1049273172 8:141706901-141706923 CACTGAGGAGGGAGGGGAGCAGG + Intergenic
1049323638 8:142010624-142010646 CCCTGAGCAGGGTGGGTAGTGGG - Intergenic
1049526842 8:143131185-143131207 TCCTGAGTAGGGACAGCAGAGGG + Intergenic
1049600383 8:143504787-143504809 CTCTGCGAAGGGACGGCAGTGGG - Intronic
1051819606 9:21149481-21149503 CCCTGGTTGGGGAGGGCTGTGGG + Intergenic
1052093135 9:24354604-24354626 CCCTGAGTTGGCACGGCAATCGG - Intergenic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1053145695 9:35710757-35710779 CTCGGAGGAGAGAGGGCAGTAGG - Intronic
1055135497 9:72824492-72824514 CTCTCAGCAGAGAGGGCAGTTGG + Intronic
1055416745 9:76091955-76091977 TCCTGAGTTGAGAGGACAGTAGG - Intronic
1057175350 9:92993221-92993243 TCCTGAGTAGGGGGGACTGTAGG + Intronic
1057180883 9:93029528-93029550 CACTTACTAGGGTGGGCAGTGGG - Intronic
1057273333 9:93663142-93663164 TCCTGAGTAGGTAGTGCTGTGGG + Intronic
1058613936 9:106805728-106805750 CCCTGAGTAGGTAGGACTATAGG + Intergenic
1058704591 9:107627927-107627949 CCCTGCTGAGGGAGGGCAGGAGG + Intergenic
1059336531 9:113572566-113572588 CCCTGAAGGAGGAGGGCAGTGGG + Intronic
1060554656 9:124502004-124502026 CCCTGAGGGGGCCGGGCAGTGGG - Intronic
1061119179 9:128632764-128632786 GCCTGAGCAGGGAGGGCAGGTGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061352187 9:130074109-130074131 GCCTGAGCAGGGAGGTGAGTTGG + Intronic
1061404267 9:130384933-130384955 CTCTGAGGAGGGGGAGCAGTGGG + Intronic
1062036175 9:134383602-134383624 CCCAGAGTGGGGCGGGGAGTGGG - Intronic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062397103 9:136356933-136356955 CCCAGAGTGGGGAGGGCAGGGGG + Intronic
1189730843 X:44019103-44019125 ACCTGAGTAGGCAGGGGAGCTGG - Intergenic
1195615231 X:106906653-106906675 CCCTGAGAAGAGAGGGCTGGAGG - Intronic
1196816054 X:119666387-119666409 CCCAGAGTGGGGAGGGGAGATGG - Intronic
1197320863 X:125029094-125029116 CATTGAGTAGTGATGGCAGTTGG + Intergenic
1198000816 X:132433773-132433795 CCATGAAGGGGGAGGGCAGTGGG - Intronic
1198250127 X:134871586-134871608 CCCTGAGGAGAGAGAGCTGTTGG + Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic