ID: 1080779799

View in Genome Browser
Species Human (GRCh38)
Location 11:35419565-35419587
Sequence GTTAAAGGAGTTGCCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080779799_1080779808 8 Left 1080779799 11:35419565-35419587 CCGCCTCGGGCAACTCCTTTAAC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1080779808 11:35419596-35419618 CCCGCCCCCATCTCCAGTCGCGG 0: 1
1: 0
2: 1
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080779799 Original CRISPR GTTAAAGGAGTTGCCCGAGG CGG (reversed) Intronic
901280640 1:8031758-8031780 GTTAAGTGATTTGCCCGAAGTGG - Intergenic
901612190 1:10507795-10507817 GATAAAGGATTTACCTGAGGGGG - Intronic
903214574 1:21836716-21836738 GTTAAAGCACCTGCCCCAGGGGG - Intronic
905176831 1:36141657-36141679 GTTAAAGAATGTGCCCAAGGAGG + Intronic
917534407 1:175863967-175863989 GATAGAGGAGTCGCTCGAGGAGG + Intergenic
918269828 1:182887273-182887295 TATAGAGGAGTTTCCCGAGGTGG + Exonic
1063621205 10:7650815-7650837 GTAAAATGATTTCCCCGAGGTGG - Intronic
1064768853 10:18702882-18702904 GTTAAATAATTTGCCCAAGGTGG - Intergenic
1070778018 10:79121372-79121394 GTTAGAGGGGGTTCCCGAGGAGG + Intronic
1071852340 10:89586766-89586788 TTTAAAGGAGGTGACAGAGGAGG + Intronic
1074570149 10:114616942-114616964 GTTAAGGGACTTGCCCAAGGTGG + Intronic
1080779799 11:35419565-35419587 GTTAAAGGAGTTGCCCGAGGCGG - Intronic
1083951200 11:65957394-65957416 GTGACAGGAGCTGGCCGAGGCGG - Intronic
1083999528 11:66288713-66288735 GTCAAAGGAGTTTCTGGAGGAGG + Intronic
1087093435 11:94298516-94298538 GTTAAAGTATTTGCATGAGGTGG + Intergenic
1092765684 12:11850733-11850755 ATTAAAGGGCATGCCCGAGGAGG + Intronic
1093795393 12:23304148-23304170 GTTGGAGGAGCTGCCTGAGGAGG - Intergenic
1095237705 12:39818095-39818117 GTCAGAGGAGTGGCCCAAGGGGG - Intronic
1101479407 12:105083163-105083185 GTGAAAGGTGTTGACAGAGGAGG + Intronic
1117517534 14:56517052-56517074 GTAAAAGAAGTTTCCTGAGGAGG - Intronic
1118916810 14:70114616-70114638 TTTAATGGAATTGCCAGAGGAGG - Intronic
1121546125 14:94765005-94765027 GTGAAAGCAGTTGCCCCTGGGGG - Intergenic
1125742988 15:41980418-41980440 GTTAAAAGAGAGGCCAGAGGAGG + Intergenic
1127067428 15:55255284-55255306 ATTAAAGGAATACCCCGAGGAGG - Intronic
1128474918 15:67989068-67989090 GAAAAAGGAGATGCCCGAGGTGG - Intergenic
1132372563 15:101308667-101308689 GTTAGAGGACTTGCCAGAGGGGG + Intronic
1140016787 16:71194873-71194895 GTTAAAGGACTTGTGAGAGGAGG - Intronic
1140092570 16:71850315-71850337 GTTAAATGAGTGGGCCGGGGAGG - Exonic
1142520918 17:503973-503995 GTTAAAGGAGTATTCCGGGGAGG + Intergenic
1142520952 17:504113-504135 GTTAAAGGAGTATTCCGGGGAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150543570 17:66129426-66129448 GTTATGTGAGTCGCCCGAGGTGG - Intronic
1155994960 18:32321436-32321458 GATAGAGGAGTTCCCCCAGGAGG - Intronic
1160617418 18:80142206-80142228 GGTAAATGACTTGCCTGAGGTGG + Intronic
1162102434 19:8347786-8347808 GTTTAAGGAGTTCCTCCAGGGGG + Intronic
1163896998 19:20067974-20067996 TTTAAAGGAGTTGCCCCATTGGG - Intergenic
1165866069 19:38939818-38939840 GGTGAAGGAGTGGCCTGAGGCGG + Intronic
1166563688 19:43750253-43750275 GTTCAAGGAGTAGCCATAGGAGG - Intronic
925448438 2:3948144-3948166 GTAAAAGGATTTCCCTGAGGAGG + Intergenic
927973674 2:27322164-27322186 GATAAAGGCATTGCCCCAGGAGG - Intronic
935913991 2:107928884-107928906 ATTAGAGTAGTTGCCTGAGGTGG + Intergenic
937229635 2:120390119-120390141 GTAAAAGGAGTGGCATGAGGAGG - Intergenic
937534262 2:122866768-122866790 GGTAAAGAAGTTGCCCTGGGAGG + Intergenic
938802277 2:134774293-134774315 GTTAAAGAACTTGCTCAAGGGGG - Intergenic
940932962 2:159457742-159457764 GGTAAAGGAGTGGCCCTGGGAGG - Intronic
942693227 2:178609704-178609726 GTTGGAGGAGTAGCCCGAGAAGG + Exonic
1180735495 22:18013428-18013450 GTTAAAAGATGTGCCCAAGGTGG + Intronic
1182991809 22:34775226-34775248 GTTAAGTGACTTGCCCGAGGTGG - Intergenic
1184358586 22:43999238-43999260 GTTTAAGGAGCTGCCGGAGATGG - Exonic
950287899 3:11759459-11759481 GTTGAAGGAGTTCCCTCAGGAGG - Intergenic
952443376 3:33356326-33356348 AATAAAGGAGTTGCTCGAGTTGG + Intronic
960220310 3:115100103-115100125 GCTAAAGGAGATGACAGAGGGGG + Intronic
969640886 4:8397751-8397773 GTCAGAGGAGTGGCCCGATGGGG - Intronic
973344317 4:49037898-49037920 GTTAAGACAGTTGCCCGAGTAGG + Intronic
990788533 5:59450790-59450812 GTGGAAGGATTTGCCCGAGTTGG - Intronic
1000794027 5:165642410-165642432 GGTAAAGGAGTGGCTTGAGGAGG - Intergenic
1012931537 6:105322428-105322450 GTTAAATGACTTGCCCCACGTGG + Intronic
1015813780 6:137186773-137186795 GTCAAAGGAGTCGCCCCAGAAGG - Intergenic
1021346921 7:19540162-19540184 GTGAAAGGAGTTGCCAGAAAGGG + Intergenic
1023703139 7:42912046-42912068 GATGCAGGAGGTGCCCGAGGCGG - Exonic
1024887707 7:54163296-54163318 GTTAAAGGACTTGCCCCAGAAGG - Intergenic
1034669664 7:152848412-152848434 TTTAAAGGAGTTGTCTGTGGTGG + Intronic
1035434363 7:158848514-158848536 GTTAAAGGACTCGCCCCAGAAGG + Intergenic
1038114739 8:24540755-24540777 GCTAAAGGAGATGCCAGAGAGGG + Intergenic
1039603847 8:38864920-38864942 GTTAAAAGATTTCCCCGAGCAGG - Intergenic
1043629163 8:82307131-82307153 GTTAAATGACTTGCCCAAGGCGG + Intergenic
1044950083 8:97427515-97427537 GATTAAGGAGTTGCAAGAGGAGG + Intergenic
1057046800 9:91892381-91892403 GGTAAGGGACTTGCCCAAGGTGG - Intronic
1061087641 9:128408641-128408663 GGTAAAGGAGTTGGAGGAGGGGG + Intergenic
1193298782 X:79864420-79864442 GTTAAATCAGTTGCCAGAGACGG - Intergenic
1194853639 X:98901003-98901025 TTTAAGGGACTTGCCCAAGGTGG - Intergenic
1196647048 X:118128985-118129007 GTTCAAGGAGGGGGCCGAGGAGG + Intergenic