ID: 1080785302

View in Genome Browser
Species Human (GRCh38)
Location 11:35469927-35469949
Sequence CTGTGATCATATTAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1345
Summary {0: 1, 1: 1, 2: 15, 3: 172, 4: 1156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080785302_1080785304 -6 Left 1080785302 11:35469927-35469949 CCTACTTCCTAATATGATCACAG 0: 1
1: 1
2: 15
3: 172
4: 1156
Right 1080785304 11:35469944-35469966 TCACAGCAAGAGTTACAGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080785302 Original CRISPR CTGTGATCATATTAGGAAGT AGG (reversed) Intronic
900874946 1:5335482-5335504 ATGTGATCTTATTTGGAAATAGG - Intergenic
901219694 1:7576387-7576409 CAGTGATGGTATTAGGAAGTGGG + Intronic
901243687 1:7711292-7711314 ACGTGATGGTATTAGGAAGTGGG - Intronic
902080866 1:13819891-13819913 CTGTGATGGTATTTGGAGGTGGG - Intronic
902416251 1:16241490-16241512 ATGTGACCATATTTGGAAATAGG - Intergenic
902446166 1:16465955-16465977 ATGTGATCTTATTTGGAAATAGG - Intergenic
902630928 1:17704119-17704141 ATGTGATGATATTTGGAGGTGGG - Intergenic
903051479 1:20604473-20604495 AAGTGATGGTATTAGGAAGTGGG - Intronic
903619461 1:24687369-24687391 CTTTGATTATATTAGGATGGTGG - Intergenic
904862009 1:33545621-33545643 CAGTGATAGTATTAGGAAGTGGG - Intronic
905017659 1:34788580-34788602 GTGTGATGGTATTAGGAGGTGGG + Intronic
905496745 1:38395253-38395275 ATGTGATAATATTAGGAGATGGG + Intergenic
905545416 1:38794482-38794504 GTGTGATGATATTTGGAAATGGG - Intergenic
905649917 1:39649422-39649444 ATGTGATGATATTAGGAGGTCGG + Intergenic
905994147 1:42366392-42366414 ATGTGATGGAATTAGGAAGTGGG + Intergenic
906370703 1:45250966-45250988 ATGTGATCTTATTTGGAAATAGG + Intronic
906717052 1:47978090-47978112 ATGTGACGGTATTAGGAAGTGGG + Intronic
906823285 1:48951485-48951507 ATGTGATAGTATTAGGAAGTAGG + Intronic
906830831 1:49030176-49030198 ATGTGATGCTATTAGGAGGTGGG + Intronic
907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG + Intronic
907079179 1:51605600-51605622 CTGGTATCATATTTGGAGGTGGG + Intronic
907598943 1:55747236-55747258 TTGTGATAATATTAAGAGGTGGG - Intergenic
907709487 1:56865510-56865532 ATCTGATGGTATTAGGAAGTGGG - Intronic
907715504 1:56922531-56922553 ATGGGATGGTATTAGGAAGTGGG + Intergenic
908021771 1:59905464-59905486 GTGTGATGATATTAGGAGGTGGG - Intronic
908326820 1:63031241-63031263 ATGTGATCTTATTTGGAAATAGG + Intergenic
908345301 1:63226383-63226405 ATGTGATAGTATTAGGAAGTGGG + Intergenic
908430799 1:64055074-64055096 ATGTGATCTTATTTGGAAATAGG - Intronic
908774070 1:67623452-67623474 CTGTGTTCACATAAGTAAGTAGG + Intergenic
908846383 1:68328771-68328793 AGGTGATAGTATTAGGAAGTGGG + Intergenic
909191333 1:72556474-72556496 ATGTGATGGCATTAGGAAGTGGG - Intergenic
909197485 1:72646518-72646540 ATGTAATAATATTAGGAGGTGGG + Intergenic
909456514 1:75855770-75855792 ATGTGATCTTATTTGGAAATAGG - Intronic
909567903 1:77076311-77076333 ATGTGATGATATTTGGAGGTGGG - Intergenic
909634332 1:77798805-77798827 ATGTGATCATATTTGAAAATAGG - Intronic
909892510 1:81025379-81025401 CTGTGATCTTACTTGGAAATAGG - Intergenic
909945356 1:81657181-81657203 ATGTGATCATATTAAAAGGTGGG + Intronic
910011945 1:82475216-82475238 ATGTGTTGATATTATGAAGTAGG - Intergenic
910093628 1:83494796-83494818 CAGTGATAGTATTAAGAAGTGGG - Intergenic
910166107 1:84329048-84329070 CAGTGAGGATATTAGGAGGTGGG + Intronic
910175187 1:84422461-84422483 TTGTGATGATATTAAGAAGTGGG - Intergenic
910399097 1:86820805-86820827 GTGTGATAATATTAGGAGGCAGG - Intergenic
910436077 1:87207517-87207539 ATGTGACCATATTTGGAAATAGG + Intergenic
910483029 1:87679215-87679237 ATGTGATCATATTAGGAGGTAGG + Intergenic
910568815 1:88677458-88677480 ATGTGATAATATTAGGAGGTGGG - Intergenic
910654726 1:89608354-89608376 ATGTGATGGTATTAGGAGGTGGG + Intergenic
910656109 1:89620255-89620277 GTGTGATAGTATTAAGAAGTGGG - Intergenic
911059691 1:93737283-93737305 ATGTGATCCTATTTGGAAATAGG + Intronic
911096021 1:94055713-94055735 TTGTGATCATTTTAGAAAATTGG + Intronic
911145465 1:94548203-94548225 ATGTGATCGTATTAAGAGGTGGG - Intergenic
911377552 1:97069636-97069658 AGGTGATGGTATTAGGAAGTGGG - Intergenic
911582078 1:99645555-99645577 ATGTGACTATATTAAGAAGTTGG - Intergenic
911595353 1:99793437-99793459 CTGTGATGTTATTTGGAAATGGG - Intergenic
911713129 1:101097961-101097983 GTGTGATAATACTGGGAAGTAGG + Intergenic
912164884 1:107031170-107031192 GTGTGATGGTATTAAGAAGTAGG + Intergenic
912174082 1:107137097-107137119 ATGTGATGGTATTAGGAGGTAGG + Intergenic
912186522 1:107283053-107283075 AAATGATGATATTAGGAAGTGGG - Intronic
912200500 1:107452490-107452512 CTGTGGTAGTATTGGGAAGTGGG + Intronic
912583817 1:110743577-110743599 CTGTACTAATATAAGGAAGTGGG + Intergenic
912749204 1:112271661-112271683 CTGTGACCTTATTTGGAAATAGG - Intergenic
912908594 1:113733519-113733541 ATGTGATCGTATTAGGAGATGGG + Intronic
912938912 1:114027648-114027670 ATGTGATCTTATTTGGAAATAGG - Intergenic
913346314 1:117814342-117814364 ATGTGATAATACTAGGAGGTGGG + Intergenic
913355243 1:117913801-117913823 ATGTGATGGTATTAGGAGGTAGG + Intronic
913394229 1:118348853-118348875 TTATGGTGATATTAGGAAGTAGG + Intergenic
913485378 1:119328488-119328510 CTGTCATCATCTTTGGAAATGGG + Intergenic
913649190 1:120894329-120894351 GTGTGATGATATTTGGCAGTGGG + Intergenic
914077511 1:144369178-144369200 GTGTGATGATATTTGGCAGTGGG - Intergenic
914101668 1:144597327-144597349 GTGTGATGATATTTGGCAGTGGG + Intergenic
914172418 1:145237718-145237740 GTGTGATGATATTTGGCAGTGGG - Intergenic
914297296 1:146340184-146340206 GTGTGATGATATTTGGCAGTGGG - Intergenic
914354677 1:146873966-146873988 TTGTGATGGTATTGGGAAGTGGG - Intergenic
914527061 1:148478721-148478743 GTGTGATGATATTTGGCAGTGGG - Intergenic
914639335 1:149588414-149588436 GTGTGATGATATTTGGCAGTGGG + Intergenic
914748681 1:150517498-150517520 GTGTGATGGTATTAGGAGGTGGG + Intergenic
915152921 1:153849365-153849387 TTGTAATAATATTAAGAAGTGGG - Intronic
915754816 1:158249512-158249534 ATGTTATGTTATTAGGAAGTGGG - Intergenic
915758561 1:158287447-158287469 GTGTGATTATATTTGGAAATGGG - Intergenic
915780624 1:158546221-158546243 ATGTGACCATATTTGAAAGTAGG - Intergenic
915826416 1:159082726-159082748 ATGTGATGATATTAGGAGGTGGG - Intronic
915939205 1:160107976-160107998 ATGTGATGGTATTAGGAGGTGGG - Intergenic
916247607 1:162704728-162704750 ATGTGATAGTATTAGGAAGTAGG - Intronic
916297100 1:163231402-163231424 TTGTGATCATGTTAGGGACTAGG + Intronic
916313454 1:163422273-163422295 GTGTGATGATATTAGGAGATGGG - Intergenic
916513507 1:165494588-165494610 GTGTGATGGTATTAGGAGGTGGG + Intergenic
916598739 1:166271994-166272016 CTGTGATGGTATTAGGAGGTGGG - Intergenic
916686979 1:167156463-167156485 ATGTGATAGTATTAAGAAGTGGG - Intergenic
917724550 1:177816305-177816327 CAGTGATGATATTAGGAGGTGGG + Intergenic
917742332 1:177972780-177972802 ATGTGATGGTATTAGGAGGTAGG + Intronic
918025503 1:180740995-180741017 ATGTGATGGTATTAGGAGGTGGG - Intronic
918482143 1:184990444-184990466 AGGTGATGATATTAGGAGGTGGG + Intergenic
918524091 1:185446237-185446259 GTGTGATGATATTTGGAGGTAGG - Intergenic
918759582 1:188386123-188386145 ATGTGATAATATTAAGAGGTGGG + Intergenic
918985584 1:191621358-191621380 ATGTAATACTATTAGGAAGTGGG + Intergenic
918988688 1:191668165-191668187 CTGTGATCATATCAGCAAAGTGG + Intergenic
919109343 1:193198296-193198318 CTGTGGTGATATTAAGAAGTAGG + Intronic
919319138 1:196012254-196012276 ATGTGATCTTATTTGGAAATAGG - Intergenic
919365992 1:196661641-196661663 ATGTGATAGTATTAGGAGGTGGG - Intronic
919588449 1:199469044-199469066 ATGTGATGATATTAGGAGGTGGG - Intergenic
919687641 1:200499191-200499213 AGGTGATGATATTAGGAGGTGGG + Intergenic
919985625 1:202672275-202672297 GTGTGATGGTATTTGGAAGTGGG + Intronic
920169704 1:204064011-204064033 CTGGGATCCTATTAAGATGTGGG - Intergenic
920223120 1:204418802-204418824 ATGTGATCTTATTTGGAAATAGG + Intergenic
920368731 1:205463553-205463575 ATGTGATCTTATTTGGAAATAGG - Intergenic
920798253 1:209161399-209161421 GTGTGATGATATTTGGAGGTGGG + Intergenic
920918348 1:210276841-210276863 GTGTGATGGTATTAGGATGTAGG + Intergenic
921022845 1:211252279-211252301 CTGTGATTGTATTAAGAGGTGGG + Intergenic
921126489 1:212182539-212182561 GTGTGATAGTATTAGGAGGTGGG - Intergenic
921882125 1:220267332-220267354 GTCTGATTATATTAGGATGTTGG + Intronic
921941187 1:220841614-220841636 ATGTGATCATATTAGGAGATGGG + Intergenic
921989640 1:221350666-221350688 GTGGGATGGTATTAGGAAGTGGG - Intergenic
922346599 1:224701540-224701562 ATGTGATGGTGTTAGGAAGTGGG - Intronic
922360102 1:224813361-224813383 ATGTGATGATATTAGGAGGTGGG + Intergenic
922896443 1:229104314-229104336 ATGTGATAGTATTAGGAAATGGG + Intergenic
922972661 1:229755959-229755981 ATGTGATGGTATTAGGAGGTGGG - Intergenic
923130959 1:231074389-231074411 AGGTGATGATATTAGGAGGTGGG + Intergenic
923993876 1:239470036-239470058 ATGTGACCTTATTTGGAAGTAGG + Intronic
924047522 1:240047159-240047181 GTGTGATGGTATTTGGAAGTAGG + Intronic
924119170 1:240779018-240779040 GTGTGATGCTATTAGGAGGTGGG + Intronic
924163363 1:241256794-241256816 ATGAGATGATATTAAGAAGTAGG - Intronic
924163411 1:241257356-241257378 ATATGATAATATTAAGAAGTAGG - Intronic
924240253 1:242033312-242033334 ATGGGATGGTATTAGGAAGTGGG - Intergenic
924398976 1:243657090-243657112 AGGTGATGGTATTAGGAAGTGGG + Intronic
924557600 1:245131036-245131058 ATGTGATCTTATTTGGAAATAGG - Intergenic
924867977 1:248006650-248006672 ATGTGATAATATTAGGAGTTGGG + Intronic
924938585 1:248793253-248793275 ATGTGATGATATTAGGAGATGGG + Intergenic
1063142619 10:3268770-3268792 CTGTGATGGTGTTAGGAGGTGGG - Intergenic
1063204282 10:3815912-3815934 AGGTGATCGTATTAGGAGGTGGG + Intergenic
1063387934 10:5628093-5628115 ATGTGATTATATTTGGAGGTAGG - Intergenic
1063754473 10:8991602-8991624 CTGTGGTCATATTTGGAAATAGG + Intergenic
1063878762 10:10509336-10509358 ATGTAACAATATTAGGAAGTGGG + Intergenic
1063986030 10:11503443-11503465 CTGTGATTACATTAAAAAGTAGG + Intronic
1064352197 10:14586461-14586483 ACGTGATGATATTTGGAAGTGGG + Intronic
1064574682 10:16732347-16732369 ATGTGATGGTATTTGGAAGTAGG + Intronic
1065492521 10:26296225-26296247 ATGTGATGATATTAGGAGATAGG - Intronic
1065663101 10:28026496-28026518 CAGTGATTGCATTAGGAAGTAGG + Intergenic
1065857620 10:29842980-29843002 AGGTGATGGTATTAGGAAGTGGG - Intergenic
1066008065 10:31166215-31166237 CTGTGATGGTATTAGAAAGCAGG + Intergenic
1066019489 10:31283770-31283792 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1066147407 10:32575930-32575952 ATGTGAACTTATTAGGATGTTGG - Intronic
1066160496 10:32722706-32722728 ATGTGATCTTATTTGGAAATAGG - Intronic
1066198687 10:33126142-33126164 CTGAGATATTCTTAGGAAGTCGG + Intergenic
1066751102 10:38658323-38658345 ATGTGATAATATTAAGAGGTGGG + Intergenic
1066965943 10:42264769-42264791 ATGTGATAATATTAAGAGGTGGG - Intergenic
1067512041 10:46904238-46904260 CTGTGATCACATTAGGATCTTGG - Intergenic
1067650206 10:48147586-48147608 CTGTGATCACATTAGGATCTTGG + Intergenic
1068088918 10:52408668-52408690 ATGTGATCGTATTAAGAGGTCGG + Intergenic
1068382889 10:56281624-56281646 GTGTAATCTTATTTGGAAGTAGG + Intergenic
1068391471 10:56402635-56402657 ATGTGATGATATTAGGAGGTGGG - Intergenic
1068454282 10:57235015-57235037 GTGTGATGGTATTTGGAAGTTGG + Intergenic
1068499747 10:57829547-57829569 ATGTGATGGTATTTGGAAGTGGG + Intergenic
1069471503 10:68695289-68695311 CTGTAATAATGTTAGAAAGTAGG - Intergenic
1069695678 10:70383527-70383549 ATGTGATCTTATTTGGAAGTAGG + Intergenic
1070224953 10:74494279-74494301 ATCTTATCATAGTAGGAAGTTGG - Intronic
1070573361 10:77658472-77658494 GTGTGATAGTTTTAGGAAGTAGG + Intergenic
1070715486 10:78717996-78718018 GTGTAATCATATTAAGAGGTGGG + Intergenic
1071056736 10:81520183-81520205 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1071727029 10:88209246-88209268 ATGTGATCTTATTTGGAAATAGG + Intergenic
1071845178 10:89514665-89514687 ATGTGATGGTATTTGGAAGTGGG - Intronic
1071930386 10:90463153-90463175 ATGTGATGATACTAGGAGGTGGG + Intergenic
1072642347 10:97221492-97221514 ATGTGATGATATTAGGAGGTAGG + Intronic
1073001486 10:100289202-100289224 ATGTGATAGTATTAGGAGGTGGG + Intronic
1073569636 10:104566805-104566827 CTGTGATAGTATTAAGAAGTGGG + Intergenic
1074014715 10:109522401-109522423 ATGTGATCATATTAGGAGATAGG - Intergenic
1074358743 10:112808242-112808264 ATGTGATCTTATTTGGAAATAGG - Intronic
1074660480 10:115650235-115650257 CTTTGAACATATTGGGAAGAAGG - Intronic
1074671912 10:115800675-115800697 ATGTGATGGTATTAAGAAGTGGG + Intronic
1074972274 10:118548858-118548880 ATGTGATCGTATTTGGAGGTAGG + Intergenic
1075053181 10:119198490-119198512 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1075637182 10:124037199-124037221 CTGTGACCTTATTTGGAAATAGG - Intronic
1075951813 10:126485069-126485091 GTGTGATATTATTAGGAGGTAGG + Intronic
1076161137 10:128245122-128245144 ATGTGATGGTATTAGGCAGTAGG - Intergenic
1076167287 10:128292814-128292836 AGGTGATGATACTAGGAAGTAGG - Intergenic
1077582632 11:3426619-3426641 CTGTGACCTTATTAGGAAATAGG + Intergenic
1078443142 11:11384198-11384220 GTGTGATGGTATTAGGAGGTAGG + Intronic
1078499034 11:11850998-11851020 ATATGATGATATTAGGAAGTGGG - Intronic
1078710228 11:13783998-13784020 ATGTGATGGTATTAGGACGTGGG - Intergenic
1078712498 11:13807948-13807970 ATGTGATCTTATTTGGAAATAGG - Intergenic
1079353279 11:19711523-19711545 GTGTGATGGTATTAGGAGGTGGG - Intronic
1079503128 11:21125002-21125024 GGGTGATGGTATTAGGAAGTGGG - Intronic
1079611368 11:22436411-22436433 ATGTGATAGTATTAGGAAGTAGG - Intergenic
1079620851 11:22552190-22552212 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1079815596 11:25053163-25053185 CTGTGATCAAATGAAGATGTAGG + Intronic
1080113777 11:28599179-28599201 ATGTGATCTTATTTGGAAATAGG + Intergenic
1080114026 11:28601696-28601718 ATGTGATTGTGTTAGGAAGTGGG - Intergenic
1080154997 11:29099346-29099368 ATGTGATGATATTTGGAGGTGGG - Intergenic
1080205603 11:29725497-29725519 ATGTGATAATATTAAGAGGTGGG + Intergenic
1080260540 11:30345042-30345064 CAGTGATGGTATTAGGAGGTGGG - Intergenic
1080785302 11:35469927-35469949 CTGTGATCATATTAGGAAGTAGG - Intronic
1081452332 11:43183488-43183510 ATGTGACCTTATTTGGAAGTAGG + Intergenic
1081598927 11:44478649-44478671 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1081695267 11:45105246-45105268 ATGTGATGGTATTAGGAGGTGGG - Intronic
1081924696 11:46815603-46815625 CTGTTATCAGATTAAGAATTAGG - Intronic
1082868229 11:57919192-57919214 CTGTGACCTTATTTGGAAGTAGG + Intergenic
1083456661 11:62783510-62783532 CTGTGATAATATTAAGAGGGAGG + Intronic
1086105135 11:83139266-83139288 CTGTGATCTTACTAAGAACTTGG - Intergenic
1086129962 11:83391027-83391049 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1086214000 11:84355346-84355368 AGATGATGATATTAGGAAGTGGG + Intronic
1086880507 11:92148003-92148025 CAGTGAACATACGAGGAAGTGGG - Intergenic
1086902054 11:92378959-92378981 AGGTGATAATATTAGGAAGTAGG - Intronic
1087003534 11:93445301-93445323 TTGTGATGGTATTAGGAAATTGG - Intergenic
1087186527 11:95204522-95204544 ATGTGATGGTATTAGGAGGTGGG + Intronic
1087737538 11:101851786-101851808 ATGTGATGGTATTAGCAAGTGGG - Intronic
1087779858 11:102290658-102290680 CTGTGATGGTATCAGGAGGTGGG - Intergenic
1087790418 11:102400622-102400644 GTGTGATGATATTTTGAAGTGGG + Intronic
1087923163 11:103890169-103890191 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1087923206 11:103890535-103890557 GTGTGATCATATTTGAAAGTGGG - Intergenic
1087992570 11:104763805-104763827 GTGTGATGGTATTAGGAAGTAGG + Intergenic
1088015453 11:105053504-105053526 ATGTGCTCTTATTAGGAAATAGG + Intronic
1088059628 11:105631216-105631238 CTGTGATTATATTGGGAAGGAGG + Intronic
1088890474 11:114040331-114040353 AGGTGATGATATTAGGAAGTAGG - Intergenic
1088917477 11:114238573-114238595 AGGTGATGGTATTAGGAAGTGGG - Intronic
1088934639 11:114387355-114387377 ATGTGATAATATTAGGAAGTAGG + Intergenic
1088983840 11:114888325-114888347 TAGTGATGATATTAGGAGGTAGG - Intergenic
1089165870 11:116476042-116476064 ATGTGATCTTATTTGGAAATTGG + Intergenic
1090196860 11:124823993-124824015 CTGAGATCTTATCAGGAAGCTGG - Intergenic
1091129249 11:133130989-133131011 GTGTGATGATATTTGGAGGTGGG + Intronic
1091511897 12:1135524-1135546 ATGTGACCATATTTGGAAATAGG + Intronic
1091924552 12:4334407-4334429 ATGTGATCGTATTAGGAGGCAGG - Intronic
1092395074 12:8118792-8118814 GTGTGATGATATTAAGAGGTGGG + Intergenic
1092413250 12:8270326-8270348 ATGTGACCTTATTAGGAAATAGG - Intergenic
1092529467 12:9332495-9332517 ATGTAATGATATTAGGAGGTGGG + Intergenic
1092941079 12:13407781-13407803 CAGTGACCATATTTGGAAATAGG - Intergenic
1094045675 12:26163687-26163709 ATGTGATAATATTAAGAGGTGGG - Intronic
1094089798 12:26636023-26636045 CTGTGATCTTACTTGGAATTGGG - Intronic
1094123196 12:26995632-26995654 GTGTGATGATATTAGGAGGTGGG + Intronic
1094165186 12:27436178-27436200 CTGTGATGGTATTAGGAGGTGGG - Intergenic
1094216515 12:27948435-27948457 GTGTGATGGTATTAGGAAGTGGG + Intergenic
1094598617 12:31888445-31888467 ATGGGATGGTATTAGGAAGTGGG - Intergenic
1094635427 12:32222695-32222717 ATGTGATAATATTAAGAAGTCGG + Intronic
1095159403 12:38899216-38899238 ATGTGATGATATTAGGAGGTAGG + Intronic
1095775134 12:46002277-46002299 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1095903085 12:47348712-47348734 CTGTGATGACATTAGGAGGTGGG + Intergenic
1096505494 12:52089879-52089901 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1096753427 12:53778621-53778643 CTGTGTCCATTTTAGGAATTGGG + Intergenic
1097346323 12:58497479-58497501 ATGTGATCATATTAGGAGATGGG + Intergenic
1097350035 12:58538658-58538680 ATGTGACCTTATTTGGAAGTAGG + Intergenic
1097803878 12:63944477-63944499 ATGTGATAATATTTGGAGGTTGG - Intronic
1098164255 12:67677376-67677398 CTGTGATGGTATTAGGAAGTGGG - Intergenic
1098624159 12:72641912-72641934 ATATGATAGTATTAGGAAGTAGG + Intronic
1099390363 12:82071675-82071697 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1099415135 12:82375208-82375230 GTGTGATGGTATTAAGAAGTAGG + Intronic
1099621679 12:85009294-85009316 CTGTGATGGTATTAAGAAGTGGG - Intergenic
1099648460 12:85392189-85392211 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1099870299 12:88339962-88339984 ATGTGATCTTATTTGGAAATAGG - Intergenic
1099892112 12:88602707-88602729 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1100004811 12:89881927-89881949 CTATGAACATATTTGGGAGTGGG - Intergenic
1100229474 12:92592810-92592832 ATGTGATGATATTGGGAGGTAGG - Intergenic
1100233973 12:92638780-92638802 ATGTAATGGTATTAGGAAGTAGG - Intergenic
1100333782 12:93610557-93610579 ATGTGGTAATATTAAGAAGTAGG + Intergenic
1100408722 12:94293996-94294018 GTGTGATGGTATTAGGAGGTAGG - Intronic
1100476529 12:94940463-94940485 ATGTGATGGTATTAGGAGGTAGG + Intronic
1100477401 12:94947079-94947101 ATGTGATCTTATTTGGAAATAGG + Intronic
1100984915 12:100194533-100194555 ATGTGATGATATTTAGAAGTGGG - Intergenic
1101051830 12:100871860-100871882 ATGTGATGACATTAGGAGGTAGG - Intronic
1101069048 12:101053733-101053755 ATGTGACCTTATTTGGAAGTAGG - Intronic
1102559526 12:113752416-113752438 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1102799448 12:115718701-115718723 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1102889041 12:116543886-116543908 ATGTCATCTTATTAGGAAATAGG - Intergenic
1103845960 12:123902261-123902283 ATGTGACCTTATTTGGAAGTGGG - Intronic
1104002898 12:124871766-124871788 ATGTGATGGTATTAGGAGGTAGG + Intronic
1104110028 12:125696139-125696161 ATGTGATGGTATTAGGAGGTTGG - Intergenic
1105529890 13:21209614-21209636 ATGTGATAATATTAAGAAGTGGG + Intergenic
1105614704 13:22001214-22001236 CTGTGACCATGATAGGATGTGGG + Intergenic
1106051968 13:26199863-26199885 ATGTGATAGTATTAGGAAGTGGG + Intronic
1106392693 13:29350923-29350945 ATGTCATCACATTAGGAATTAGG + Intronic
1106551119 13:30771930-30771952 AGGTGATGATATTAGGAGGTCGG + Intergenic
1106643115 13:31606883-31606905 ATGTGATGGTATTAGGAAGCAGG + Intergenic
1106732181 13:32552709-32552731 ATATGATCATATTAAGAAGTGGG + Intergenic
1106761242 13:32869917-32869939 GTGTGATCATATTAGAAAGTGGG + Intergenic
1106764153 13:32897182-32897204 ATGTGATCTTATTTGGAAATGGG + Intergenic
1106764633 13:32901677-32901699 CTGTGATGATATTTGGAGATTGG - Intergenic
1106773984 13:32990896-32990918 ATGTGATCATATTTGGAAATAGG - Intergenic
1106829111 13:33559466-33559488 ATGTGATGATATTAGGACTTGGG + Intergenic
1107235911 13:38170198-38170220 CTGTGATCATTCTAAGTAGTTGG + Intergenic
1107561353 13:41560071-41560093 CTGTGATGGTATCAGGAGGTGGG - Intergenic
1107603530 13:42037759-42037781 GGGTGATGGTATTAGGAAGTAGG - Intergenic
1107710074 13:43142756-43142778 ATGTGATCTTATTTGGAAATAGG + Intergenic
1108276196 13:48812105-48812127 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1108618956 13:52162319-52162341 ATGTGATCTTATTTGGAAATAGG - Intergenic
1109346011 13:61114929-61114951 CAGTAATCATATTAGGAAACTGG + Intergenic
1109369274 13:61400155-61400177 AGGTGATAATATTAGGATGTGGG + Intergenic
1109398494 13:61792677-61792699 GTGTGATAATATTAAGAGGTGGG + Intergenic
1109715101 13:66211879-66211901 ATGTGATGGTATTTGGAAGTGGG - Intergenic
1109859143 13:68174051-68174073 ATGTGTTGTTATTAGGAAGTGGG - Intergenic
1110042782 13:70786419-70786441 ATGTGATAGTATTTGGAAGTGGG + Intergenic
1110360955 13:74625044-74625066 ATGTGATAATATTAAGAGGTGGG - Intergenic
1110522875 13:76501551-76501573 AAGTGATGATATTAGGAAATGGG + Intergenic
1110778672 13:79439456-79439478 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1110817259 13:79875891-79875913 ATGTGATAGTATTAGGAGGTAGG - Intergenic
1110827806 13:79993133-79993155 ATGTGATAATATTAAGAGGTGGG - Intergenic
1110925338 13:81143565-81143587 ATGTGATGCTATTAGGAAGTGGG - Intergenic
1110950541 13:81484009-81484031 ATGTGATGGTATTAGGATGTAGG - Intergenic
1111333358 13:86790547-86790569 ATGTGATGATATTAAGAAGTGGG - Intergenic
1111382549 13:87478061-87478083 ATGTGATGCTATTAGGAGGTGGG + Intergenic
1111453450 13:88448746-88448768 GTGTGATGGTATTTGGAAGTGGG + Intergenic
1111519246 13:89378777-89378799 TTGTGATGGTATTAGGAGGTAGG - Intergenic
1111537953 13:89628610-89628632 ATGTGATGATATTAGGAGATGGG + Intergenic
1111551123 13:89814227-89814249 ATGTGATCTTATTTGGAAATAGG + Intergenic
1111840597 13:93445341-93445363 CTATGACAGTATTAGGAAGTAGG - Intronic
1112243194 13:97702445-97702467 AGGTGATGGTATTAGGAAGTGGG - Intergenic
1112485554 13:99816544-99816566 ATGTGATGGTATTTGGAAGTGGG + Intronic
1112574862 13:100626876-100626898 ATGTGATGGTATTGGGAAGTAGG + Intronic
1112608113 13:100927952-100927974 ATGCAATCATATTAGGAGGTGGG - Intergenic
1112664676 13:101556237-101556259 ATGTGATCTTATTTGGAAATTGG + Intronic
1112696034 13:101949286-101949308 CAGTGATCGCATTAGAAAGTAGG - Intronic
1112884965 13:104158941-104158963 ATGTGATGTTATTAGGGAGTGGG - Intergenic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113016858 13:105837552-105837574 CTATGATCATATTTAAAAGTGGG - Intergenic
1113017248 13:105841325-105841347 ATGTGATCTTATTTGGAAATAGG - Intergenic
1113264453 13:108601964-108601986 GTGTGGTCATATTAGGAGGCTGG + Intronic
1114084282 14:19228092-19228114 ATGTGATGATATTTGGAGGTAGG + Intergenic
1114381226 14:22206454-22206476 GTGTGATGGTATTAGGAAGTAGG + Intergenic
1114402196 14:22420286-22420308 ATGTGATCTTATTTGGAAATAGG + Intergenic
1114720590 14:24877135-24877157 CTGTGAACATATTAGAAATCTGG + Intronic
1115317843 14:32044912-32044934 CTGTGGTCAGATTAGAAGGTTGG - Intergenic
1115374994 14:32665099-32665121 CTGTGACCATATTTGGGGGTGGG + Intronic
1115712448 14:36065940-36065962 AGGTGATAATATTAGGAGGTGGG + Intergenic
1115941033 14:38609908-38609930 TTGTAATAATATTAGGAAGTGGG - Intergenic
1115946619 14:38668545-38668567 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1116072419 14:40065366-40065388 CATTGGTTATATTAGGAAGTAGG - Intergenic
1116111783 14:40594422-40594444 ATGTGATGGTATTAGGAAGTGGG + Intergenic
1116176038 14:41471640-41471662 ATGTTATCATATTTGGAAATTGG - Intergenic
1116177034 14:41484299-41484321 ATGTGATGGTATTAGGAAGAGGG - Intergenic
1116251938 14:42497257-42497279 CTTTGAACTTATTAGGAAGTTGG - Intergenic
1116308401 14:43288585-43288607 ATATGATGATATTAGGAGGTGGG - Intergenic
1116433933 14:44876151-44876173 AAGTGATGATATTAGGAGGTGGG - Intergenic
1116763360 14:49041389-49041411 ATGTGATCATATTTGGAGATAGG - Intergenic
1116853535 14:49931713-49931735 ATGTGACCATATTTGGAAATAGG - Intergenic
1117087618 14:52218014-52218036 ATGTGATGGTATTAAGAAGTGGG - Intergenic
1117435159 14:55708829-55708851 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1117678432 14:58178866-58178888 AGGTGATGGTATTAGGAAGTGGG - Intronic
1117906825 14:60598088-60598110 TAGTGATTGTATTAGGAAGTGGG - Intergenic
1118015502 14:61656346-61656368 TTGTGATCATCTTAGAAAGCAGG - Intronic
1118082125 14:62372613-62372635 ATGTGATGGTATTAAGAAGTTGG - Intergenic
1118095614 14:62533765-62533787 ATGTGAACTTATTAGGAAATAGG - Intergenic
1118868831 14:69724961-69724983 ATGTGATCATATTTGGAGATAGG + Intergenic
1119167316 14:72505461-72505483 ATGTGATCGTATTAGGAGGCAGG - Intronic
1119537214 14:75412307-75412329 AAGTGATGGTATTAGGAAGTAGG + Intergenic
1119876142 14:78061016-78061038 AGGTGATGGTATTAGGAAGTGGG + Intergenic
1119882537 14:78112401-78112423 GTGTGATGGTATTAGGAGGTGGG + Intergenic
1120415571 14:84214932-84214954 ATGTAATGATATTAGGAGGTGGG + Intergenic
1120415902 14:84217524-84217546 CTGTGATGATTTTAGGAGGTGGG + Intergenic
1120629449 14:86872353-86872375 CTGATATCATATTAAGATGTAGG - Intergenic
1120739795 14:88095428-88095450 ATGTGATCTTATTTGGAAATAGG - Intergenic
1120916239 14:89713055-89713077 CTGTGATGGTATTAAGAGGTGGG - Intergenic
1120989511 14:90362851-90362873 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1121006420 14:90493432-90493454 TTGTGATGGTATTAGGAGGTGGG + Intergenic
1121303526 14:92890420-92890442 GTGTGATGGTATTAGGAGGTAGG + Intergenic
1121658764 14:95618975-95618997 ATGTGATCATATTTGAAAATAGG - Intergenic
1121798300 14:96753737-96753759 CTGTGACCAAATTTGGAAATAGG - Intergenic
1121835097 14:97085168-97085190 ATGTGATAATATTGGGAGGTGGG - Intergenic
1121875753 14:97450023-97450045 AAGTGATGGTATTAGGAAGTTGG - Intergenic
1121879474 14:97487183-97487205 GTGTGACCATATTTGGAAATAGG - Intergenic
1121941798 14:98077823-98077845 GTGTGATGATTTTAGGAAGGGGG - Intergenic
1121945983 14:98122485-98122507 CTGTGACCATATTTGGAGATAGG + Intergenic
1122369534 14:101221688-101221710 AAGTGATGATATTAGGAAGTGGG + Intergenic
1122495866 14:102154475-102154497 ATGTGATAATATCAGGAGGTAGG - Intronic
1122730128 14:103790402-103790424 ATGTGGTAATATTAGGAGGTGGG + Intronic
1202895894 14_GL000194v1_random:9954-9976 ATGTGATGATATTTGGAGGTAGG + Intergenic
1123738051 15:23204699-23204721 ATGTGATTTTATTTGGAAGTAGG + Intergenic
1124062144 15:26303487-26303509 AGGTGATGGTATTAGGAAGTTGG - Intergenic
1124289262 15:28433363-28433385 ATGTGATTTTATTTGGAAGTAGG + Intergenic
1124293960 15:28483945-28483967 ATGTGATTTTATTTGGAAGTAGG - Intergenic
1124498093 15:30200040-30200062 ATGTGATGATATTAAGAGGTAGG - Intergenic
1124745489 15:32338630-32338652 ATGTGATGATATTAAGAGGTAGG + Intergenic
1124829711 15:33136478-33136500 CTGTTATAAAATTAGGAAGTGGG - Intronic
1124919147 15:34008020-34008042 GTGTGATCTTATTTGGAAATAGG - Intronic
1125153783 15:36563322-36563344 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125207219 15:37167377-37167399 CTGTGAGCCTGTTAGGAACTGGG + Intergenic
1125347604 15:38733828-38733850 ATGTGACAATATTTGGAAGTGGG - Intergenic
1125365162 15:38905561-38905583 ATGTGATGATATTAAGATGTAGG - Intergenic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1126377934 15:48014824-48014846 AGGTGATGATATTAGGAGGTAGG - Intergenic
1126699156 15:51352352-51352374 ATGTGATGATATTAGGAGGTGGG - Intronic
1126956039 15:53934911-53934933 ATGTAATGATATTAGGATGTGGG - Intergenic
1127122280 15:55781858-55781880 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1127492247 15:59476178-59476200 ATGTGATGGTATTAGGAGGTGGG - Intronic
1127834110 15:62776171-62776193 CTTAGACCATATTAGGAAGTAGG - Intronic
1128235091 15:66061542-66061564 CTGTGATCATCTTATTGAGTAGG - Intronic
1128320220 15:66688226-66688248 ATGTGATGATATTAGGAGGTGGG - Intergenic
1128469835 15:67943001-67943023 ATGTGATGATATTAGGAAGTGGG + Intergenic
1128660952 15:69500674-69500696 ATGTGATCTTATTTAGAAGTAGG - Intergenic
1128786945 15:70404606-70404628 CTGTGATGGAATTAGGAGGTGGG + Intergenic
1128796812 15:70472337-70472359 ATGCAATCATATTAGGAGGTGGG - Intergenic
1128875253 15:71196235-71196257 ATGTGATAATATTAAGAAGTGGG - Intronic
1129081264 15:73043129-73043151 AGGTGATGGTATTAGGAAGTGGG - Intergenic
1129705012 15:77789203-77789225 ATGTGATCTTATTTGGAAATTGG + Intronic
1130057340 15:80537851-80537873 ATGTGACCATATTTGGAAATAGG + Intronic
1130177747 15:81592769-81592791 ATGTGATCGTATTAGGAGGTGGG + Intergenic
1130265775 15:82401719-82401741 ATGTGATGATATTAAGAGGTAGG - Intergenic
1130331687 15:82927057-82927079 ATGTGATGGTATTAGGAGGTGGG - Intronic
1130506238 15:84545196-84545218 ATGTGATGATATTAAGAGGTAGG + Intergenic
1131718715 15:95143208-95143230 TTGTGATGATATTGAGAAGTGGG - Intergenic
1131901969 15:97097720-97097742 GTGTCATGATATTAGGAGGTGGG + Intergenic
1132075894 15:98819364-98819386 ATGTGATGATATTAGGAGCTGGG + Intronic
1132422764 15:101687743-101687765 AGGTGATGGTATTAGGAAGTAGG + Intronic
1132667098 16:1086480-1086502 CTGTGATGGTATTAAGAGGTGGG - Intergenic
1133133810 16:3695156-3695178 ATGTGACCATATTTGGAAATAGG - Intronic
1133203997 16:4222002-4222024 ATGTGACCTTATTTGGAAGTAGG - Intronic
1133537600 16:6716902-6716924 ATGTGATGGTATTAGGAGGTGGG + Intronic
1133813353 16:9178027-9178049 AGGTGATAATGTTAGGAAGTGGG - Intergenic
1134257187 16:12622094-12622116 CTGTGATCATCTCGGGAAGAGGG - Intergenic
1134296273 16:12948726-12948748 TAGTGATGATATTAAGAAGTGGG - Intronic
1134372277 16:13636690-13636712 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1134638543 16:15811030-15811052 AAGTGATGATATTAGGAGGTGGG + Intronic
1134902756 16:17953455-17953477 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1135472635 16:22745123-22745145 ATGTGATGGTATTTGGAAGTAGG + Intergenic
1135578587 16:23605783-23605805 ATGTGATGGTATTAGGAGGTGGG + Intronic
1135835103 16:25818208-25818230 GTGTGATGGTATTAGGAGGTGGG + Intronic
1135846367 16:25922231-25922253 GTGTGATGGTATTAGGAGGTGGG + Intronic
1135890926 16:26356492-26356514 ATGTGATTATAATTGGAAGTTGG - Intergenic
1135961885 16:27001823-27001845 CTGTGATTGTATTAGGAGTTAGG - Intergenic
1135974318 16:27097402-27097424 ATGTAACCATATTAAGAAGTGGG - Intergenic
1136019686 16:27432115-27432137 ATGTGATCATATTAAAAGGTGGG - Intronic
1136055411 16:27684883-27684905 CTGTGACCTTATTTGGAAATAGG - Intronic
1136658400 16:31729547-31729569 CTGTGATAGAATTAAGAAGTGGG - Intronic
1137863842 16:51873329-51873351 AGTTGATCATATTAGGAGGTGGG + Intergenic
1138307594 16:55991870-55991892 GTGTGATGGTATTAGGAGGTGGG + Intergenic
1138437796 16:57015304-57015326 GTGTGATGGTATTTGGAAGTGGG - Intronic
1138646466 16:58429048-58429070 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1138647439 16:58435417-58435439 ATGTGATGGTACTAGGAAGTGGG + Intergenic
1138730285 16:59186546-59186568 GTGTGATGGTATTAGGAAGTGGG - Intergenic
1138848566 16:60597871-60597893 CTGTGTTCATATCAGCTAGTGGG - Intergenic
1139093452 16:63676734-63676756 ATGTGATGGTATTAGGAGGTCGG + Intergenic
1139177594 16:64708420-64708442 ATGTGATGCTATTAGGGAGTTGG + Intergenic
1139238955 16:65370769-65370791 AGGTGATGATATTAGGAGGTGGG - Intergenic
1139299860 16:65935722-65935744 CTGGGATGATAATAGGAAGGTGG - Intergenic
1139674762 16:68515851-68515873 ATGTGATTGTATTAGGAGGTGGG - Intergenic
1139979343 16:70841566-70841588 TTGTGATGGTATTGGGAAGTGGG + Intronic
1140231924 16:73124436-73124458 ATGTGATGATATCAGGAGGTGGG - Intergenic
1140614983 16:76651251-76651273 CTGTGACCTTATTTGGAAATTGG + Intergenic
1140923758 16:79563922-79563944 CTGTGATCATTTTTGGATGTTGG + Intergenic
1141002787 16:80323920-80323942 ATGTGACCTTATTTGGAAGTGGG - Intergenic
1141248547 16:82333548-82333570 CCGTGAGCACATTGGGAAGTTGG + Intergenic
1141457632 16:84154416-84154438 ATGTGATGGTATTAGGAGGTGGG - Intronic
1202994764 16_KI270728v1_random:98485-98507 ATGTGATAATATTAAGAGGTGGG + Intergenic
1203021451 16_KI270728v1_random:410827-410849 ATGTGATAATATTAAGAGGTGGG + Intergenic
1142647865 17:1327063-1327085 ATGTGATGGTATTAGGATGTGGG + Intergenic
1143466341 17:7139306-7139328 GTGTGATGATATTTGGAGGTGGG - Intergenic
1143782393 17:9236074-9236096 GTGTGAGAATATTAAGAAGTAGG - Intronic
1144001987 17:11063816-11063838 GTGTGATGGTATTTGGAAGTGGG - Intergenic
1144095433 17:11896209-11896231 ATGTGATCTTATTTGGAAATAGG - Intronic
1144405907 17:14952567-14952589 CTCTGATCATAAAAGGATGTTGG + Intergenic
1145745783 17:27318650-27318672 ATGTAATGATATTAGGGAGTGGG + Intergenic
1145849341 17:28076472-28076494 ATATGATGGTATTAGGAAGTGGG - Intronic
1146710092 17:35033572-35033594 ATGTGATCAGATTAGGGGGTAGG + Intronic
1147321647 17:39650134-39650156 ATGTGATCTTATTTGGAACTGGG + Intronic
1148957039 17:51362519-51362541 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1149136908 17:53377803-53377825 TTGTCATCATATAAGGATGTTGG + Intergenic
1149177866 17:53896084-53896106 CGGAGATCACATTAGGAATTTGG + Intergenic
1149565663 17:57639139-57639161 AGGTGATGATATTAGGAGGTGGG - Intronic
1149628765 17:58101927-58101949 ATGTGATAAGATTAGGAGGTGGG - Intergenic
1149646200 17:58243428-58243450 ATGTGACCTTATTTGGAAGTAGG - Intronic
1150159257 17:62881122-62881144 TTGTGATGGTATTAAGAAGTGGG - Intergenic
1150751147 17:67863715-67863737 ATGTGATCTTATTTGGAAATAGG - Intronic
1150835479 17:68560011-68560033 GTATGATAGTATTAGGAAGTGGG + Intronic
1150873863 17:68946486-68946508 AAGTCATGATATTAGGAAGTAGG + Intronic
1151061573 17:71100706-71100728 CTGTGATCTTACTTGGAAATAGG - Intergenic
1151106668 17:71623633-71623655 CTGTGATGGTATTAGGAGGTAGG - Intergenic
1151265199 17:72949679-72949701 CAGTGATTGTATTAGGAGGTGGG - Intronic
1151687095 17:75654043-75654065 TTGTAAACATATTGGGAAGTTGG - Intronic
1153161187 18:2206407-2206429 ATGTGATGATATAAGGAGGTGGG - Intergenic
1153912168 18:9713961-9713983 ATGTGAGGATATTAGGAGGTGGG - Intronic
1153980713 18:10307223-10307245 TTGTGATGCTATTAAGAAGTGGG + Intergenic
1154013312 18:10594175-10594197 ATGTGATGGTATTAGGAAGAAGG + Intergenic
1154152485 18:11917438-11917460 ATGTGATGGTATTAGGAAGAAGG + Intergenic
1154958123 18:21279642-21279664 CTGTGTTCATTTTAAGAGGTGGG + Intronic
1155043209 18:22082348-22082370 ATGTGATGGTATTAGGAAGTGGG - Intergenic
1155579632 18:27288350-27288372 GTGTGATGATATTTGGAGGTGGG + Intergenic
1155587823 18:27388192-27388214 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1155605997 18:27606560-27606582 ATGTGATGATATTTGGAAGCAGG - Intergenic
1155829860 18:30500551-30500573 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1155833023 18:30541945-30541967 ATGTGATGTTATCAGGAAGTGGG - Intergenic
1155913461 18:31532374-31532396 GTATGATCATATTAAGAGGTGGG - Intronic
1155921618 18:31609260-31609282 GTGTGACCTTATTCGGAAGTAGG - Intergenic
1156535663 18:37862361-37862383 GTGTGATGATATTAAGAGGTGGG + Intergenic
1156566497 18:38197243-38197265 ATGTGATAGTATTAAGAAGTGGG - Intergenic
1157085547 18:44576990-44577012 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1157103396 18:44750441-44750463 GTGTGATGATATTAGGAGGTGGG - Intronic
1157243484 18:46033299-46033321 CTGTGACCTTATTTGGAAATAGG + Intronic
1157906969 18:51577861-51577883 GGTTGATGATATTAGGAAGTGGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158092435 18:53729570-53729592 CTGTTTTCAGATTTGGAAGTAGG + Intergenic
1158422356 18:57306441-57306463 CTGTGTCCTTATCAGGAAGTTGG - Intergenic
1158619857 18:59023507-59023529 ATGTGATCTTATTTGGAAATAGG - Intergenic
1158638205 18:59179721-59179743 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1158789223 18:60755848-60755870 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1158903061 18:61984250-61984272 GTGTGATCGTATTTGGAGGTGGG - Intergenic
1159272956 18:66176532-66176554 CTGAGATCAGATTAATAAGTTGG - Intergenic
1159456863 18:68670081-68670103 TTGTGATCTTATTTGGAAATAGG - Intergenic
1159521589 18:69531901-69531923 ATGTGATGATATTAGGAGATGGG + Intronic
1159781859 18:72668833-72668855 ATGTGATAATATTTGGAGGTTGG + Intergenic
1159934401 18:74350870-74350892 AGGTGATGATATTAGGAGGTAGG + Intronic
1160053821 18:75461227-75461249 ATGTGATCTTATTAGGAGGCGGG - Intergenic
1160067091 18:75585472-75585494 ATGTGATCTTATTTGGAAATAGG - Intergenic
1160071838 18:75635821-75635843 CTCTGATGGTATTAGGAGGTGGG - Intergenic
1162270229 19:9608338-9608360 CTGTGAAGACATGAGGAAGTGGG + Exonic
1162335507 19:10057822-10057844 ATGTGATCTTATTTGGAAATTGG - Intergenic
1162840734 19:13354715-13354737 ATGTGATCTTATTTGGAAATAGG + Intronic
1162849712 19:13421548-13421570 ATGTGAAGATATTAGGAAGTGGG + Intronic
1163150156 19:15407002-15407024 CTGTAATCCTTTTGGGAAGTGGG + Intronic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1163585190 19:18160141-18160163 CTGTGACCTTATTTGGAAATAGG - Intronic
1164852061 19:31492248-31492270 ATGTGATGGTGTTAGGAAGTGGG - Intergenic
1165563848 19:36706255-36706277 ATGTGATAGTATTACGAAGTAGG - Intronic
1165600066 19:37047231-37047253 ATGTCATAGTATTAGGAAGTAGG + Intronic
1167725383 19:51208767-51208789 ATGTGATGATATTTGGAGGTGGG - Intergenic
1168716791 19:58533318-58533340 TTGTGATGATATTTGGAAATGGG - Intronic
925213626 2:2073121-2073143 AGGTGATGGTATTAGGAAGTTGG - Intronic
925498031 2:4473973-4473995 CTGTAATGGTATTAGGAGGTGGG + Intergenic
925642481 2:5999278-5999300 ATGTGATGGTATTAGGAGGTGGG - Intergenic
925687538 2:6488743-6488765 CAGGGATGATATTTGGAAGTGGG + Intergenic
925812176 2:7711509-7711531 CTGAGATGATATTAGGAGATGGG + Intergenic
925880660 2:8349734-8349756 ATGTGATGGTATTAGGAGGTGGG - Intergenic
926283555 2:11469568-11469590 ATGTGATCATATTCGGACATGGG + Intergenic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926573325 2:14553706-14553728 ATGTGATGGTATTAGGAGGTGGG + Intergenic
926834782 2:17006373-17006395 ATGTGATAGTATTAGGAAGTTGG - Intergenic
926841546 2:17086463-17086485 ATGTGATCTTATTTGGAAATAGG + Intergenic
927162719 2:20283447-20283469 GTCTGATCATAATAGGCAGTTGG + Exonic
927292950 2:21422475-21422497 ATGTGATGATATTAGGAGGTGGG + Intergenic
927415588 2:22876731-22876753 CTGTGATTATATTTGTATGTTGG - Intergenic
927943471 2:27120306-27120328 CTGTGACCTTATTTGGAAATAGG + Intergenic
928439997 2:31284431-31284453 ATGTGATGGTATTAGGAGGTGGG + Intergenic
928611790 2:32998633-32998655 ATGTGATGGTATTAGGAGGTGGG + Intronic
928717851 2:34083408-34083430 CTGTGATAGTATTAAGAGGTTGG - Intergenic
928767620 2:34666455-34666477 AGGTGATAGTATTAGGAAGTGGG + Intergenic
929030042 2:37641482-37641504 CTGAGATCATTTTAGGGAGAGGG - Intergenic
929236692 2:39612578-39612600 ATGTGATCGTATTAAGAGGTAGG - Intergenic
929278629 2:40053386-40053408 GTGTGATCGTGTTAGGAGGTTGG + Intergenic
929350521 2:40947011-40947033 CTGTGATGGTATTAAGAACTGGG - Intergenic
929483207 2:42332362-42332384 CTGTGATAATGGTTGGAAGTGGG + Exonic
929815997 2:45232087-45232109 ATGTGATCATATTAGGAGGTGGG - Intergenic
929929535 2:46241795-46241817 CTGTGTTCATAATTGGAAGCTGG - Intergenic
930476407 2:51888108-51888130 ATGTGATGATATTAAGAAGTGGG - Intergenic
930496365 2:52149435-52149457 CTGTGATGGTATTAGAAAGTGGG + Intergenic
930582595 2:53230004-53230026 CTGTGATGGTATTTGGAGGTGGG - Intergenic
930673451 2:54175867-54175889 GTGTGATGGTATTAGGGAGTGGG + Intronic
930878463 2:56245711-56245733 ATGTGATGGTATTAGGAGGTGGG + Intronic
930983397 2:57555383-57555405 ATGTGATGATATTAGAAAGCTGG + Intergenic
931424106 2:62155146-62155168 ATGTGATCTTATTTGGAAATAGG - Intergenic
931570617 2:63665528-63665550 ATGTGATCTTATTTGGAAGCAGG - Intronic
931803779 2:65784811-65784833 GTGTGATAATATTAGGATATGGG - Intergenic
932260971 2:70327131-70327153 CTGTGATCTTATTTGGAAATAGG + Intergenic
932299146 2:70653100-70653122 ATGTGATTGTATTAGGAGGTGGG + Intronic
932544249 2:72690874-72690896 ATGTGATCTTATTTGGAATTAGG + Intronic
932821440 2:74905080-74905102 ATGTGATGGTTTTAGGAAGTAGG - Intergenic
933183927 2:79258107-79258129 ATGTGATCTTATTTGGAAATAGG - Intronic
933461609 2:82594372-82594394 CTGTCATCTGATGAGGAAGTGGG + Intergenic
933532401 2:83526899-83526921 ATGTGACCTTATTTGGAAGTAGG - Intergenic
934014254 2:87862254-87862276 ATGTGATGGTATTAGGAGGTAGG + Intergenic
934049495 2:88198483-88198505 CTGTGACCTTATTTGGAAATAGG + Intergenic
934314096 2:91900491-91900513 ATGTGATAATATTAAGAGGTGGG + Intergenic
934551985 2:95268330-95268352 CTGTGATCAGAGTAGGTAATGGG + Intergenic
934610608 2:95732545-95732567 CTGTGTGCATCTTAGGAACTTGG - Intergenic
935063656 2:99629899-99629921 ATGTGATAGTATTAGGAGGTGGG - Intronic
935268653 2:101415208-101415230 TTGTGATGGTGTTAGGAAGTGGG + Intronic
935281602 2:101522551-101522573 ATGGGATAATATTAGGAGGTGGG - Intergenic
935448443 2:103181488-103181510 ATGTGATGGTATTAGGAGGTGGG - Intergenic
935571697 2:104669104-104669126 CTGTGAGCTTATTAGGTATTGGG - Intergenic
935685291 2:105677660-105677682 ATGTGATAGTATTAGGAGGTGGG + Intergenic
935740668 2:106144838-106144860 CAGTGATGGTATTAGGAGGTGGG - Intronic
935758113 2:106293392-106293414 ATGTGATGGTATTAGGAGGTGGG + Intergenic
935874951 2:107496346-107496368 CTATGACCATATTTGGAAATAGG - Intergenic
936023145 2:109010660-109010682 GTGTGATGGTATTAGGAGGTGGG - Intergenic
936238329 2:110765794-110765816 AGGTGATTATATTAGAAAGTAGG - Intronic
936543950 2:113374127-113374149 CTGTGTGCATCTTAGGAACTTGG - Intergenic
936599833 2:113884917-113884939 GGGTGATGGTATTAGGAAGTGGG - Intergenic
937242568 2:120471806-120471828 CTGTGATGGTGTTAGGAGGTGGG - Intergenic
937567490 2:123312474-123312496 ATGTAATGATATTAGGAGGTGGG - Intergenic
937743939 2:125388445-125388467 CATTGATATTATTAGGAAGTTGG - Intergenic
937901586 2:127023782-127023804 GTGTGATGGTATTAGGAGGTGGG - Intergenic
938162932 2:129002786-129002808 ATTTGATGGTATTAGGAAGTGGG + Intergenic
938492305 2:131767997-131768019 ATGTGATGATATTTGGAGGTAGG - Intergenic
938495264 2:131794353-131794375 ATGTGATGATATTTGGAGGTAGG + Intergenic
938672461 2:133599139-133599161 CTGTGAACTTATTTGGAAATAGG - Intergenic
938683846 2:133717929-133717951 GTGTGATGGTATTAGGAGGTGGG - Intergenic
938760899 2:134424966-134424988 ATGTGATCTTATTTGGAAATAGG - Intronic
938946242 2:136214574-136214596 CTGTGTTTATCTTAGGGAGTTGG + Intergenic
939040564 2:137184314-137184336 ATGTGATAATATTAAGAAGAGGG - Intronic
939451033 2:142375383-142375405 ATGTGGTAATATTAGGCAGTAGG + Intergenic
939826111 2:147017319-147017341 ATGTGATTTTATTAGGATGTGGG - Intergenic
940285544 2:152029675-152029697 CGGTGATGGTATTAGGAGGTGGG + Intronic
940307228 2:152239571-152239593 AAGTGATCGTATTAGGAGGTAGG + Intergenic
940372795 2:152921513-152921535 GTGTGATGGTATTAGGAGGTGGG - Intergenic
940611471 2:155997968-155997990 CTGTGATGGTATTTGGAGGTGGG + Intergenic
940718579 2:157257114-157257136 ATGTGATAGTATTAGGAGGTAGG - Intergenic
941092800 2:161197808-161197830 TTGTGATGGTATTAAGAAGTGGG - Intronic
941129498 2:161628869-161628891 TTGAGATCAGATTAGGAAGTGGG + Intronic
941343475 2:164337598-164337620 CTTTGATCATTTTATGAAGAAGG + Intergenic
941529555 2:166650026-166650048 TTGTAATGATATTAAGAAGTGGG + Intergenic
941815586 2:169792436-169792458 GTGGGATGGTATTAGGAAGTGGG + Intronic
942638019 2:178029779-178029801 TTGTGATGATATTAGGAAGTGGG + Intronic
942718230 2:178919004-178919026 AGGTGATGATATTAGGAAGTAGG + Intronic
943196781 2:184763202-184763224 ATGTGATCTTATTTGGAAATAGG + Intronic
943389330 2:187244157-187244179 ATGTGATGGTATTAGGAGGTGGG - Intergenic
943759063 2:191588825-191588847 ATGTTATGATATTAGGAGGTAGG + Intergenic
943859768 2:192846507-192846529 TTGTGATGATATTAGGAGGTGGG - Intergenic
943888590 2:193255967-193255989 ATGAGATGATATTAAGAAGTGGG + Intergenic
944136773 2:196408133-196408155 TTTTGATCATATCAGGAAGGGGG - Intronic
944154636 2:196596449-196596471 ATGTGATGGTATTAGGAGGTGGG + Intergenic
945223746 2:207510872-207510894 ATATGATGATATTAGGAGGTGGG + Intergenic
945935202 2:215896873-215896895 CAGTGATGGTATTAGGAGGTGGG - Intergenic
946113237 2:217438391-217438413 ATGTGATCATATTAAAAGGTGGG + Intronic
946443133 2:219713861-219713883 GTGTGATGGTATTTGGAAGTGGG + Intergenic
946619284 2:221544127-221544149 AGGTGATGGTATTAGGAAGTAGG - Intronic
946698660 2:222387489-222387511 CTGTGATGGTATTTGGAGGTGGG - Intergenic
946738704 2:222780349-222780371 ATGTGACCTTATTTGGAAGTAGG + Intergenic
946909792 2:224448305-224448327 ATGTGATGGTATTAGGAGGTAGG + Intergenic
947321953 2:228929628-228929650 CTGTCAACATATTTGGAATTTGG - Intronic
947358898 2:229326302-229326324 AAGTGATGATATTAGGAGGTAGG + Intergenic
947647563 2:231754966-231754988 ATGTGATGGTATTAGGAGGTGGG + Intronic
947845159 2:233237832-233237854 GTGTGATGGTATTTGGAAGTGGG - Intronic
947902966 2:233738066-233738088 CTATGATGAGATTAGGAGGTGGG - Intronic
948120048 2:235523238-235523260 CTGTGATGTCATGAGGAAGTGGG - Intronic
948130448 2:235596810-235596832 GTGTGATGGTATTAGGAGGTGGG + Intronic
948286486 2:236789908-236789930 ATGTGACCTTATTTGGAAGTAGG + Intergenic
1168884171 20:1233756-1233778 ATGTGATGGTATTAGGAGGTGGG - Intronic
1169447891 20:5687732-5687754 ATGTGATCTTATTTGGAAATAGG - Intergenic
1169603862 20:7293279-7293301 ATGTGATATTATTAGGAGGTGGG + Intergenic
1169684102 20:8251231-8251253 CTGTGATCGTATTAAGAGGTAGG - Intronic
1169782673 20:9326091-9326113 ATGTGATGGAATTAGGAAGTGGG - Intronic
1169997912 20:11579426-11579448 CTGTGGTAATTCTAGGAAGTTGG - Intergenic
1170147986 20:13198471-13198493 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1170273133 20:14550406-14550428 ATGTGATTGTATTAGGAGGTGGG + Intronic
1170275730 20:14584611-14584633 ATGTGATGGTATTTGGAAGTGGG - Intronic
1170473368 20:16690284-16690306 CTCTGATCATAGGAGAAAGTGGG - Intergenic
1170476689 20:16721901-16721923 CTGTGACATTATTAGGAAATAGG + Intergenic
1170722748 20:18898198-18898220 CTGTGATGGTATTAGGAGGTGGG + Intergenic
1170728389 20:18949664-18949686 ATGTGATTGTATTAGGAGGTCGG - Intergenic
1170946800 20:20898673-20898695 ATGTGATTGTATTAGGAGGTGGG + Intergenic
1171008221 20:21489359-21489381 GTGTGATGCTGTTAGGAAGTGGG - Intergenic
1171054587 20:21894006-21894028 ATGTGATAGTATTAAGAAGTGGG + Intergenic
1171132617 20:22667575-22667597 TTGTGACCATATTAAGAAGTGGG - Intergenic
1171524885 20:25801064-25801086 ATGTCATAAGATTAGGAAGTAGG - Intronic
1171551942 20:26054819-26054841 ATGTCATAAGATTAGGAAGTAGG + Intergenic
1171793052 20:29546122-29546144 ATGTCATAAGATTAGGAAGTAGG + Intergenic
1172329703 20:34066771-34066793 ATGTGATGGTATTAGGAAGTGGG - Intronic
1172514700 20:35525153-35525175 ATGTGACCTTATTTGGAAGTAGG + Intronic
1172814748 20:37677484-37677506 ATGTGATCTTATTTGGAAATGGG + Intergenic
1173058555 20:39639668-39639690 ATGTGATCTTATTTGGAAATAGG + Intergenic
1173064088 20:39692864-39692886 ATGTGATCATTTTGGGAAGATGG + Intergenic
1173197304 20:40926353-40926375 CTGTGCTAATATTAGGAAAAGGG + Intergenic
1173334839 20:42104086-42104108 ATGTGATGGTATTAGGAGGTTGG + Intronic
1173368803 20:42416053-42416075 TTGTGATCTTATTTGGAAATAGG + Intronic
1173574565 20:44103831-44103853 ATGTGACAATATTAGGAGGTGGG + Intergenic
1173641552 20:44606428-44606450 ATGTGATAATATTAAGAGGTAGG + Intronic
1174366412 20:50059233-50059255 ATGTGACCATATTTGGAAGTAGG + Intergenic
1174688481 20:52478982-52479004 ATGTGACAATATTAAGAAGTAGG + Intergenic
1174851927 20:54004108-54004130 ATGTGATGGTATTAGGAGGTGGG + Intronic
1174974349 20:55314963-55314985 CTGTGAGCTTATTTGGAAATAGG - Intergenic
1175323973 20:58109926-58109948 ATGTGATGCTATTAGGAGGTGGG + Intergenic
1175327645 20:58140874-58140896 GTGTGATCTTATTTGGAAATAGG - Intergenic
1175465396 20:59187258-59187280 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1176423724 21:6535083-6535105 ATGTGATCTTATTTGGAAGTGGG - Intergenic
1176670380 21:9728526-9728548 TTGTGATGATATTGGGAGGTGGG - Intergenic
1176709591 21:10137798-10137820 ATGTGATGATATTTGGAGGTAGG - Intergenic
1176915292 21:14618352-14618374 GTGTGATTATATGAGGAAGAGGG + Intronic
1177361729 21:20081562-20081584 ATGTGATTATATTTGGAAATAGG - Intergenic
1177603090 21:23340926-23340948 CTGGGATCATAGTGGGAAGTTGG - Intergenic
1177714175 21:24817745-24817767 ATGTGATGATATTTGGAGGTGGG + Intergenic
1177930681 21:27279115-27279137 AGATGATAATATTAGGAAGTGGG - Intergenic
1177997196 21:28115866-28115888 ATGTGATCTTATTCGGAAATAGG + Intergenic
1178066792 21:28913362-28913384 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1178137630 21:29645720-29645742 CTGTCATCATTTTAGGTAATAGG + Intronic
1178221236 21:30662392-30662414 ATGTGATCATCTTAAGAGGTGGG + Intergenic
1178237521 21:30859603-30859625 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1178348522 21:31852549-31852571 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1178482081 21:32988167-32988189 GTGGGATGATATTAGGAGGTGGG - Intergenic
1178711943 21:34925000-34925022 ATGTGATGGTATTAGGAGGTGGG - Intronic
1178735150 21:35142342-35142364 CTGGGTTCTTATTAGGAATTTGG + Intronic
1178748886 21:35281733-35281755 ATGTGATTATATTTGGAAATAGG + Intronic
1178775089 21:35542368-35542390 ATGTGATTGTATTAGGAGGTTGG - Intronic
1179058836 21:37960660-37960682 AGGTGATGATATTAGGAGGTGGG - Intronic
1179344278 21:40542457-40542479 CTGTGATTGTATTAGGAGGTGGG + Intronic
1179699217 21:43143398-43143420 ATGTGATCTTATTTGGAAGTGGG - Intergenic
1180293689 22:10865111-10865133 ATGTGATGATATTTGGAGGTAGG - Intergenic
1180496494 22:15894526-15894548 ATGTGATGATATTTGGAGGTAGG - Intergenic
1180540854 22:16446356-16446378 ATGTGATAATATTAAGAGGTGGG + Intergenic
1180993361 22:19951978-19952000 CTGGGATCATTTTAGGAATGTGG + Intronic
1181886342 22:26025079-26025101 ATATGATGATATTAGGAGGTGGG - Intronic
1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG + Intronic
1182053902 22:27334661-27334683 CTGTGATCTTATTTGGAAATAGG - Intergenic
1182810810 22:33115175-33115197 TTATGACCATATTTGGAAGTAGG + Intergenic
1182920556 22:34075321-34075343 ATGTGATTATATTAGGAGGTGGG - Intergenic
1183246756 22:36699912-36699934 CTGGGACCACCTTAGGAAGTTGG - Intronic
1183310190 22:37105388-37105410 CTGTGAACATTTGAGGAAGTGGG - Intronic
1183752721 22:39731177-39731199 ATGTGATGACATTAGGAGGTGGG + Intergenic
1184486963 22:44785580-44785602 ATGTGACCTTATTTGGAAGTCGG - Intronic
1184841926 22:47057145-47057167 GTTTGGTCATTTTAGGAAGTCGG + Intronic
1185005096 22:48271168-48271190 ATGTAATGATATTAGGAGGTGGG - Intergenic
1185076593 22:48686500-48686522 AAGTGATGGTATTAGGAAGTGGG - Intronic
949315991 3:2756255-2756277 GTGTGATCATATGAGGAGGTGGG + Intronic
949695350 3:6688348-6688370 AGGTGATGATATTAGGAGGTAGG - Intergenic
950229550 3:11264582-11264604 TTGTGATCATATTGGGAAGTGGG - Intergenic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
951084911 3:18500982-18501004 GTGTGATGACATTAGGAGGTGGG + Intergenic
951319853 3:21231238-21231260 GTGTAATGGTATTAGGAAGTGGG + Intergenic
951450835 3:22836575-22836597 CTGAGATCTTATCAGGAAGCTGG + Intergenic
951528866 3:23680328-23680350 ATGTGATCTTATTGGGAAATAGG + Intergenic
951710531 3:25581652-25581674 ATGTGATGGTATTAGGAGGTGGG + Intronic
952185872 3:30968289-30968311 ATGTAACCATATTAGGAAGATGG + Intergenic
952428503 3:33199729-33199751 GTGTGATGCTATTTGGAAGTGGG + Intronic
952441475 3:33334645-33334667 CTGTCATCAGATTTGGAATTTGG - Intronic
952509802 3:34041721-34041743 ATGTGATGATATTAGGAGGTAGG + Intergenic
952585665 3:34889083-34889105 ATGTGATGGTATTAGGAAGTGGG - Intergenic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
953051143 3:39345056-39345078 ATGTGATCTTATTTGGAAATGGG + Intergenic
953358072 3:42271205-42271227 ATGTGATGGTATTAGGAGGTGGG - Intergenic
953370038 3:42379812-42379834 ATGTGATGGTATTTGGAAGTGGG + Intergenic
953408580 3:42673627-42673649 GTGTGATAGTATTAGGAGGTAGG - Intergenic
953950466 3:47185499-47185521 AAGTGATAGTATTAGGAAGTAGG - Intergenic
954091959 3:48292092-48292114 ATGTGATGATATTTGGAAATGGG - Intronic
955010105 3:55005520-55005542 CTGTGATCAAAATGGGAATTAGG - Intronic
955127058 3:56123213-56123235 AGGTGATGGTATTAGGAAGTGGG + Intronic
955517541 3:59742627-59742649 ATGTGATGGTATTAGGAGGTAGG - Intergenic
955646172 3:61139421-61139443 ATGTGATGGAATTAGGAAGTGGG + Intronic
955714053 3:61810119-61810141 CTGTGAGCATAATAGCATGTTGG + Intronic
955833524 3:63029320-63029342 CTGTGAGCTTATTTGGAAATAGG + Intergenic
955882796 3:63565579-63565601 ATGTGATAATATTAAGAAGTAGG - Intronic
956196731 3:66660554-66660576 GTGTGATGGTATTAGGAGGTGGG + Intergenic
956230956 3:67016155-67016177 ATGTGATGGTATTAGGAGGTAGG - Intergenic
956271586 3:67453530-67453552 AGGTGATGATATTAGGAAGTGGG - Intronic
956914665 3:73858677-73858699 ATGTGATGGTATTAGGAGGTGGG - Intergenic
957239146 3:77636101-77636123 ATGTGATGATATTGGGAGGTGGG - Intronic
957260138 3:77890218-77890240 AAGTGATGATATTAGGAGGTGGG - Intergenic
957413758 3:79874211-79874233 ATGTGATGGTATTAGGCAGTAGG + Intergenic
957520108 3:81308393-81308415 ATGTGATGGTATTAGGAAGTGGG + Intergenic
957543179 3:81602637-81602659 AGGTGATCATATTAGGAAGTGGG - Intronic
957563398 3:81855081-81855103 AGGTGATGATATTAGGAGGTGGG - Intergenic
957854530 3:85857203-85857225 ATGTGATGGTATTAGGAAGTAGG - Intronic
958156898 3:89767014-89767036 GTGTGATCTTATTAGCAAATAGG - Intergenic
958263114 3:91405532-91405554 ATGTGATCTTATTTGGAAATAGG + Intergenic
958472158 3:94534353-94534375 ATGTGATAGTATTAAGAAGTGGG + Intergenic
958658570 3:97035899-97035921 GTGTGATGATATTTGGAGGTGGG + Intronic
958717300 3:97800950-97800972 ATGTGATGATATTAGGAGGTGGG - Intronic
958797912 3:98725989-98726011 CCATGATGGTATTAGGAAGTGGG - Intergenic
959123760 3:102265336-102265358 ATGTGATAGTATTAGGAGGTGGG + Intronic
959194555 3:103163023-103163045 ATGTGATAATGTTGGGAAGTGGG - Intergenic
959324482 3:104919581-104919603 TTGTGGTGGTATTAGGAAGTGGG + Intergenic
959341680 3:105139279-105139301 ATGTGACCTTATTTGGAAGTAGG + Intergenic
959497985 3:107073389-107073411 ATGTGACCATATTTGGAAATAGG - Intergenic
959508985 3:107188765-107188787 ATGTGATGATATTTGGCAGTAGG - Intergenic
959509593 3:107195915-107195937 TTGTGATGATATTAAGAGGTGGG + Intergenic
959517887 3:107290332-107290354 ATGTGATGATATTAGGAGGTGGG + Intergenic
959520830 3:107321360-107321382 ATGTGATCTTATTTGGAAATAGG - Intergenic
959638172 3:108599670-108599692 ATGTGATAGTATTAGGAGGTTGG + Intronic
959823279 3:110762677-110762699 CTGTGATAGTATTAGAAGGTGGG - Intergenic
960029721 3:113045043-113045065 AGGTGATGATATTAGGAGGTGGG + Intergenic
960268323 3:115647075-115647097 CTGAGATAGTATTAGGAGGTGGG + Intronic
960374083 3:116877331-116877353 ATGTGATGATATTAGGAGGTTGG - Intronic
960457547 3:117891575-117891597 ATGTAATGATATTAGGAAGTGGG - Intergenic
960653160 3:119974354-119974376 ATGTGATGGTATTAGGAGGTAGG + Intronic
960931260 3:122853269-122853291 AAGTGATCATATTAAGAGGTGGG - Intronic
961337003 3:126186603-126186625 CTGTGATCATAACAGGGAGCAGG + Intronic
961436088 3:126917693-126917715 ATGTGACGATATTAGGAGGTGGG + Intronic
962850317 3:139303560-139303582 CTGTGATAGTATTTGGAGGTAGG - Intronic
963178974 3:142333643-142333665 ATGGGATCATATTAGGAGGTGGG + Intronic
963200047 3:142577407-142577429 AAGTGATCATTGTAGGAAGTTGG - Intronic
963392959 3:144692400-144692422 ATGTGATGATATTCGGCAGTGGG + Intergenic
963397433 3:144751339-144751361 AGGTCATCATATTAGGAGGTGGG - Intergenic
963668845 3:148226273-148226295 AAGTGATCTTATTTGGAAGTAGG + Intergenic
963908358 3:150793008-150793030 CTGTGATAATATTAGGAGGTGGG - Intergenic
964063863 3:152558055-152558077 ATTTGATGGTATTAGGAAGTAGG - Intergenic
964340850 3:155706985-155707007 ATGTGATAGTATTAGGAGGTGGG + Intronic
964385266 3:156140570-156140592 GTGTGATGATATTAGGATATAGG - Intronic
964573143 3:158133716-158133738 ATATGATCAAATTAGGAAATGGG - Intronic
964805813 3:160608495-160608517 AGGTGATGGTATTAGGAAGTGGG + Intergenic
964828882 3:160860923-160860945 ATGTGATGATATTTGGAGGTGGG - Intronic
964913039 3:161805038-161805060 ATGTGATAGTATCAGGAAGTGGG - Intergenic
964982038 3:162696599-162696621 ATGTGATCATATTAATAACTTGG + Intergenic
965003768 3:162989651-162989673 ATGTGATTATATTTGGAGGTAGG - Intergenic
965125042 3:164616272-164616294 TTATGATGATATTAGAAAGTGGG + Intergenic
965192819 3:165553282-165553304 ATGTGACCATATTTGGAAATAGG + Intergenic
965756404 3:172032155-172032177 CAGTGATCATATTAGAAGGTGGG + Intergenic
965933894 3:174081561-174081583 ATTTGATGGTATTAGGAAGTGGG - Intronic
966433386 3:179856265-179856287 CTGTTATCATTTTACAAAGTTGG + Intronic
966647498 3:182262910-182262932 AGGTGATGATATTAGAAAGTGGG + Intergenic
967751749 3:193123165-193123187 AGGTGATACTATTAGGAAGTAGG - Intergenic
967921296 3:194616356-194616378 CTGTGACCTTATTCGGAAGTAGG + Intronic
969079799 4:4609593-4609615 GTGTGATGGTATTAGGAAGTGGG + Intergenic
969092398 4:4704657-4704679 ATGTGATCTTATTTGGAAATAGG + Intergenic
969097508 4:4744725-4744747 ATGGGATCTTATTTGGAAGTAGG + Intergenic
969340693 4:6539042-6539064 ATGTGATCTTATTTGGAAATAGG + Intronic
969362084 4:6671366-6671388 ATGTGATGATATTAGGAGGTGGG - Intergenic
969514126 4:7637139-7637161 CTGTGATCTTACTTGGAAATAGG - Intronic
969950388 4:10829630-10829652 CAGTGACAGTATTAGGAAGTGGG + Intergenic
969965139 4:10986361-10986383 ATGTGGTAGTATTAGGAAGTTGG + Intergenic
970075110 4:12209394-12209416 ATGTGATGATATTAGGAGCTGGG - Intergenic
970264377 4:14264950-14264972 ATGTGATGATATTTGGAGGTGGG + Intergenic
970343041 4:15126848-15126870 ATGTGATGGTATTAGGAGGTGGG + Intergenic
970482941 4:16496045-16496067 ATGTGATTATATTAAAAAGTGGG + Intergenic
970527727 4:16949432-16949454 ATGTGATCTTATTTGGAAATAGG - Intergenic
970606619 4:17687528-17687550 ATGTGATCTTATTTGGAAATAGG + Intronic
970866262 4:20762305-20762327 ATGTGATAGTATTAGGAGGTGGG - Intronic
970891978 4:21056807-21056829 ATGTGATAATATTGGGAAGTGGG + Intronic
970894972 4:21091848-21091870 ATGTGATAATACTAGGAGGTGGG - Intronic
970931695 4:21519122-21519144 GTGTGATGGTATTAGGAGGTGGG + Intronic
970974005 4:22022104-22022126 ATATGATGGTATTAGGAAGTGGG + Intergenic
971205184 4:24560100-24560122 CTGAGATCATAGTTGGCAGTTGG - Intronic
971225291 4:24746250-24746272 ATGTGATGGTATTAGGATGTAGG - Intergenic
971243327 4:24908096-24908118 ATGTGACCTTATTTGGAAGTAGG - Intronic
971646591 4:29214155-29214177 ATGTGATGGTATTAGGAGGTGGG + Intergenic
971712677 4:30137126-30137148 ATGTGATGGTATTTGGAAGTGGG + Intergenic
971907458 4:32745641-32745663 GTGTGATAGTATTAGGAGGTGGG - Intergenic
972291352 4:37693004-37693026 TTGTGATGGTATTAAGAAGTGGG + Intergenic
972341935 4:38159622-38159644 ATGTGACCTTATTTGGAAGTAGG - Intergenic
972377595 4:38487290-38487312 ATGTGATGGTATTAGGAGGTGGG - Intergenic
972973556 4:44606348-44606370 ATGTGATGATATTAGGAGCTGGG - Intergenic
973152084 4:46900646-46900668 CAGTGATGATATTAAGAGGTGGG + Intronic
973205259 4:47552570-47552592 AGGTGATGGTATTAGGAAGTAGG - Intronic
973551568 4:52040451-52040473 GTGTGATGATATTAGGAGGTAGG + Intergenic
973604410 4:52572156-52572178 ATGTAATGTTATTAGGAAGTGGG - Intergenic
973911612 4:55587339-55587361 ATGTGATAGTATTAGGAGGTGGG - Intronic
973916740 4:55641743-55641765 ATGTGATGATATTTGGAGGTAGG + Intergenic
973955686 4:56060717-56060739 AGGTGATGGTATTAGGAAGTGGG + Intergenic
974357029 4:60825649-60825671 GTGTTATGGTATTAGGAAGTGGG + Intergenic
974591552 4:63954438-63954460 ATGTGATGGTATTTGGAAGTAGG - Intergenic
974819699 4:67050913-67050935 CTGTCATCATATTAAGAGCTTGG + Intergenic
974843992 4:67329386-67329408 AAGTGATGATATTAGGAGGTCGG + Intergenic
975396296 4:73877733-73877755 ATGTGACCTTATTTGGAAGTAGG + Intergenic
975509357 4:75176244-75176266 TTGTGATGACATTAAGAAGTGGG + Intergenic
975600410 4:76093924-76093946 CTGTGATGGTATTTGGAGGTTGG + Intronic
976055538 4:81061334-81061356 CAGTAATCATTTTAGGTAGTTGG + Intergenic
976138756 4:81967176-81967198 CTGTGATGATATTTGGAAATTGG - Intronic
976453071 4:85214838-85214860 GCGTGATGGTATTAGGAAGTAGG + Intergenic
976505035 4:85836601-85836623 ATGTGGTCATATTTGGAAATAGG - Intronic
976989231 4:91344085-91344107 ATGTGATAGTATTAAGAAGTGGG + Intronic
977049174 4:92104866-92104888 ATGTGATCTTATTAGGTGGTGGG - Intergenic
977187320 4:93955810-93955832 ATGTGATGGTAGTAGGAAGTAGG + Intergenic
977262666 4:94816930-94816952 ATGTGATTATATTAAGATGTGGG + Intronic
977490692 4:97706336-97706358 GTGTGATAGTATTAGAAAGTTGG + Intronic
977655953 4:99520933-99520955 CTATGAACATATTATTAAGTTGG - Intronic
977946308 4:102918569-102918591 ATGTGATAATATTAAGAGGTGGG + Intronic
978014588 4:103726942-103726964 ATGTGATCGTATTTGGAAATAGG - Intergenic
978227885 4:106360617-106360639 ATGTGATCTTATTTGGAAATAGG + Intergenic
978697246 4:111597002-111597024 GTGTTATGATATTAGGAGGTGGG + Intergenic
978740522 4:112132609-112132631 GTGTGATGATATTTGGAGGTGGG - Intergenic
979604837 4:122626842-122626864 CTCTGATCATATTAGACAGGAGG - Intergenic
980609353 4:135137128-135137150 GTGTGATAGTATTTGGAAGTGGG + Intergenic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
980852263 4:138396949-138396971 ATGTGATGGTATTAGGAGGTAGG + Intergenic
981118930 4:141025893-141025915 ATGTGATGATATTTGGACGTAGG + Intronic
981157869 4:141461243-141461265 ATGTGATGATATTAAGAGGTGGG + Intergenic
981272068 4:142856959-142856981 ATGTGATAATCTTAGGAGGTGGG - Intergenic
981356224 4:143792412-143792434 GTGTGATGATATTAAGAGGTGGG + Intergenic
981367749 4:143923046-143923068 GTGTGATGATATTAAGAGGTGGG + Intergenic
981377541 4:144033294-144033316 GTGTGATGATATTAAGAGGTGGG + Intergenic
981445501 4:144832755-144832777 ATGTGATGGTATTAGGAGGTGGG + Intergenic
981547816 4:145912543-145912565 CTGTGACCTTATTGGGAAATAGG + Intronic
981569620 4:146137616-146137638 CAGTGATCAAAGTAGGAAGATGG + Intergenic
981570645 4:146147310-146147332 ATGTGATGGTATTTGGAAGTGGG + Intergenic
981628095 4:146784479-146784501 AGGTGATGATATTAGGAGGTGGG + Intronic
981686623 4:147461929-147461951 ATGTGACCATATTTGGAAATAGG + Intergenic
981697421 4:147573079-147573101 CTGTGATGGTGTTAGGAGGTGGG + Intergenic
981778549 4:148398190-148398212 ATGTGACCTTATTTGGAAGTAGG - Intronic
981971482 4:150667589-150667611 ATGTGACAATATTAGGAGGTAGG + Intronic
981992477 4:150939226-150939248 ATGTGATCTTATTTGGAAATAGG + Intronic
982125969 4:152184169-152184191 ATGTGGTCATATTAAGAGGTGGG - Intergenic
982430131 4:155313501-155313523 ATGTGATGATATTAGAAGGTGGG - Intergenic
982618120 4:157667748-157667770 ATGTGATGATATTTGGAGGTGGG - Intergenic
982851593 4:160323659-160323681 CTGTGATAATATTAAGAGTTGGG + Intergenic
982980494 4:162128352-162128374 AGGTGATAATATTAGGAGGTGGG + Intronic
983038736 4:162899052-162899074 CTGAGATCTTATTGGGAAGCTGG + Intergenic
983045563 4:162982725-162982747 TTGTGATGATACTAGGAAGTGGG - Intergenic
983125005 4:163939964-163939986 ATGTGATGGTATTAGGAGGTGGG + Intronic
983270660 4:165557885-165557907 CTGGGATGGTGTTAGGAAGTGGG + Intergenic
983574737 4:169248904-169248926 ATGTGATGGTATTAAGAAGTAGG + Intronic
983621165 4:169761996-169762018 CTGTAACCATATTTGGAAATAGG - Intergenic
983670097 4:170226822-170226844 CTGTAATTATTTTAGGAAGAGGG - Intergenic
983672308 4:170252411-170252433 ATGTGATGGTATTAGGAGGTGGG + Intergenic
983822384 4:172211908-172211930 ATGTGATTATATTGAGAAGTGGG - Intronic
983860454 4:172699198-172699220 GTGTGATGGTATTAGGAAGTGGG - Intronic
984150341 4:176122327-176122349 ATGTGATCTTATTTGGAATTAGG - Intronic
984220509 4:176969018-176969040 CTGTGATTTTATTACGATGTGGG - Intergenic
984281130 4:177672089-177672111 AAGTGATAGTATTAGGAAGTGGG - Intergenic
984399590 4:179244345-179244367 GGGTGATAATATTAGAAAGTGGG - Intergenic
984656111 4:182320617-182320639 CTGTGATCTTATTTGAAAATGGG - Intronic
984900628 4:184583102-184583124 ATGTCATAGTATTAGGAAGTAGG + Intergenic
985006421 4:185539152-185539174 GTGTGATGGTATTAGGCAGTGGG - Intergenic
985063591 4:186101498-186101520 ATGTGATCTTATTTGGAAATAGG - Intergenic
985176794 4:187210849-187210871 ATGTGATGGTATTTGGAAGTGGG - Intergenic
985318009 4:188679032-188679054 TTGTAATGATATTAGGAGGTGGG + Intergenic
985404395 4:189623014-189623036 TTGTGATGATATTGGGAGGTGGG + Intergenic
986214438 5:5705783-5705805 GTGTGATGGTATTAGGAGGTGGG - Intergenic
986230825 5:5863642-5863664 CTGTGATGGTATTTGGAGGTGGG + Intergenic
986256373 5:6104218-6104240 ATGTGATGGTATTAGGAGGTGGG - Intergenic
986261216 5:6148022-6148044 ATGTGATGATATTAAGAGGTGGG - Intergenic
986268674 5:6212364-6212386 GTGTGATGATATTTGGAGGTGGG + Intergenic
986339854 5:6779579-6779601 CTGTGACCTTATTTGGAAATGGG + Intergenic
986384008 5:7213517-7213539 ATGTGATAATATTTGGAGGTAGG + Intergenic
986480045 5:8177393-8177415 ATGTGATCATACTTGGAGGTGGG + Intergenic
986518281 5:8586323-8586345 ATGTGATCATATTAAGAGGTGGG + Intergenic
986649630 5:9950178-9950200 ATGTGATCTTATTTGGAAGAAGG + Intergenic
986745224 5:10737812-10737834 ATGTGAGCTTATTTGGAAGTGGG + Intronic
986865344 5:11980460-11980482 AGGTGATGATATCAGGAAGTGGG + Intergenic
987273885 5:16341797-16341819 ATGTGAACATATTTGGAGGTGGG + Intergenic
987442753 5:17977067-17977089 AGATGATCATATTAGAAAGTGGG - Intergenic
987466074 5:18273467-18273489 ATGTGATGATATTAGGAGGTGGG - Intergenic
987653146 5:20770843-20770865 CAGTGATGATATTTGGAGGTGGG - Intergenic
987657626 5:20826873-20826895 ATGTGATAATATTAGGAGGCTGG - Intergenic
987749022 5:22015979-22016001 CTGTTATCATCTTATTAAGTAGG + Intronic
987774098 5:22342191-22342213 GTGTGATGGTATTCGGAAGTGGG - Intronic
987795032 5:22616781-22616803 ATGTGATGGTATTAGGAGGTAGG + Intronic
987826120 5:23033393-23033415 ATGTGATGCTATTTGGAAGTGGG + Intergenic
988011987 5:25500681-25500703 ATGTGATAATATTAAGATGTGGG + Intergenic
988151291 5:27385111-27385133 CTATAATCATAAGAGGAAGTTGG - Intergenic
988231606 5:28487026-28487048 AGGGGATGATATTAGGAAGTGGG + Intergenic
988250353 5:28749240-28749262 CTGTGATCATCTTGGGGACTGGG - Intergenic
988464401 5:31474686-31474708 GTATGATGATATTAGGAGGTGGG + Intronic
988742428 5:34090641-34090663 CAGTGATGATATTTGGAGGTGGG + Intronic
988765913 5:34377081-34377103 ATGTGATAATATTAGGAGGCTGG + Intergenic
989196786 5:38724149-38724171 GTGTGATGCTATTAGGAGGTGGG - Intergenic
989321013 5:40133566-40133588 ATGTGATTATATTAGAGAGTGGG - Intergenic
989381034 5:40809683-40809705 GTGTGATTATATTAGGAGGTGGG + Intergenic
989381348 5:40812465-40812487 ATGTGATAGTATTAGGAGGTGGG - Intergenic
989728805 5:44623091-44623113 ATGTGATGATATTAGGAGGTGGG + Intergenic
990096369 5:52119293-52119315 GTGTGATGGTATTAGGAAGTGGG + Intergenic
990160176 5:52929333-52929355 ATGTGATGATATTAGGAGATGGG - Intronic
990331745 5:54734051-54734073 GTGTGATAATATTAAGAGGTGGG + Intergenic
990755677 5:59066720-59066742 ATGTGATGGTATTAGGAGGTGGG + Intronic
990841275 5:60082180-60082202 GTGTGATGACATTAGGAGGTAGG + Intronic
990845201 5:60129932-60129954 ATGTGATGATATTAGAAGGTAGG + Intronic
990910832 5:60850534-60850556 ATGTGATGATATTAGGAGGGAGG - Intergenic
990927213 5:61040140-61040162 ATGTTATCTTATTTGGAAGTAGG + Intronic
991096957 5:62749873-62749895 GTGTGAGAATATTAGGAGGTGGG + Intergenic
991292960 5:65050553-65050575 ATGTGATGGTATTAGGAGGTGGG - Intergenic
991395931 5:66205448-66205470 ATGTGATCTTATTTGGAAATAGG - Intergenic
991668320 5:69022185-69022207 CTGTGAGCTTATTTGGAAATAGG + Intergenic
991955141 5:71987001-71987023 ATGTGATAATATTAGGAGATGGG - Intergenic
992095828 5:73361638-73361660 ATGTGATTATATTAGAAGGTGGG - Intergenic
992102688 5:73422440-73422462 ATGTCATGATATTTGGAAGTGGG - Intergenic
992107703 5:73463701-73463723 ATGTGATGGTATTAGGAGGTGGG + Intergenic
992209296 5:74462121-74462143 CTGTGTTCCTATTAGGAGTTAGG + Intergenic
992263339 5:74992530-74992552 CTGTGACCTTATTTGGAAATAGG - Intergenic
992351983 5:75939481-75939503 CTATGATGGTATTTGGAAGTGGG - Intergenic
992356810 5:75994200-75994222 ATGTGATCAATTTAGGAAGAGGG + Intergenic
992578103 5:78140631-78140653 ATGTGATGGTATTAGGAGGTAGG - Intronic
992581127 5:78177621-78177643 ATCTGATCTTATTTGGAAGTGGG + Intronic
992598579 5:78371911-78371933 CTGAAATCAAATTAGGAAGGAGG + Intronic
993325191 5:86525774-86525796 ATGTGATCATATGAGGAAATGGG - Intergenic
993379309 5:87187876-87187898 CTGTGATTATATTAGGCTCTGGG - Intergenic
993831606 5:92766614-92766636 ATGTGATCTTATTAGAAAGGAGG + Intergenic
994078711 5:95682537-95682559 CTGTGATAATCTTAGGATGGTGG + Exonic
994090452 5:95805374-95805396 AGGTGATGGTATTAGGAAGTGGG - Intronic
994527536 5:100925598-100925620 ATATGATGATATTAGGAAGTGGG + Intergenic
994908740 5:105873858-105873880 ATGTGATAGTATTAGGAAATGGG - Intergenic
995094995 5:108225363-108225385 ATGTGATCTTATTTGGAAATGGG + Intronic
995126509 5:108581990-108582012 CAGTGATAGTATAAGGAAGTGGG - Intergenic
995169632 5:109091827-109091849 ATGTGATAATATTAAGAGGTGGG + Intronic
995217094 5:109607926-109607948 ATGTGATGATATTAGGAGGTGGG + Intergenic
995368358 5:111389289-111389311 ATGTGATGTTATTAGGAGGTGGG - Intronic
995602439 5:113812474-113812496 AGGTGATGGTATTAGGAAGTAGG - Intergenic
995773497 5:115699222-115699244 ATGTGATGGTATTAGGAGGTGGG + Intergenic
995835074 5:116392547-116392569 GTGTGATGGTATTAGGAGGTGGG - Intronic
995933477 5:117480709-117480731 CTGTGATGGTATTTGGAGGTAGG + Intergenic
996068268 5:119104792-119104814 CTGAGATCATAATAGTATGTGGG - Intronic
996428301 5:123339528-123339550 ATGTGATGATATTAGGAGGTGGG - Intergenic
996487328 5:124052278-124052300 ATGTGATAGTATTAAGAAGTGGG + Intergenic
996752217 5:126900341-126900363 AGGTGATGGTATTAGGAAGTGGG + Intronic
996923743 5:128799215-128799237 ATGTGATTTTATTAAGAAGTGGG + Intronic
997027169 5:130078434-130078456 GAGTGATCATATTAGCAAGATGG - Intronic
997119188 5:131156745-131156767 ATGTGATGGTATTAGGAGGTGGG - Intergenic
997190669 5:131931901-131931923 CTCTGTTCATATTTAGAAGTGGG + Intronic
998002689 5:138637300-138637322 ATGTGATGATATTAGGAGGTGGG + Intronic
998696625 5:144648045-144648067 CTGTAATGATAGTATGAAGTTGG - Intergenic
999356970 5:150944417-150944439 ATGTGATTGTATTGGGAAGTGGG + Intergenic
999461784 5:151763088-151763110 ATGTGATAGTATTAAGAAGTGGG + Intronic
999896987 5:156045205-156045227 TTGTGATGGTATTAAGAAGTTGG - Intronic
999950294 5:156642214-156642236 ATGTGATGGTATTAGGAGGTGGG - Intronic
1000125598 5:158240662-158240684 ATGTGATGGTATTAAGAAGTAGG - Intergenic
1000346466 5:160318407-160318429 ATGTGACCTTATTAGGAAATAGG - Intronic
1000510193 5:162171892-162171914 ATGTGATAATATTAGGAGATGGG + Intergenic
1000648697 5:163787984-163788006 CTGTGATGATCTTACTAAGTGGG - Intergenic
1000747805 5:165056633-165056655 ATGTGATGATATTTGGAAATGGG - Intergenic
1000919315 5:167119684-167119706 ATGTGATGATATTAAGAGGTGGG - Intergenic
1001154700 5:169262947-169262969 GTGTGATCGTATTTGAAAGTAGG + Intronic
1001251696 5:170151879-170151901 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1001701065 5:173706759-173706781 GTGTGACAGTATTAGGAAGTGGG - Intergenic
1001892088 5:175348127-175348149 CTGTGAGCATATTAGAGAGACGG + Intergenic
1001989655 5:176105743-176105765 CTGAGGTCAGATTAGGAAGGAGG + Intronic
1001989968 5:176108289-176108311 CTCAGGTCATATTAGGAAGGAGG + Intronic
1002146590 5:177187833-177187855 ATGTGATCTTATTTGAAAGTAGG - Intronic
1002226902 5:177729849-177729871 CTCAGGTCATATTAGGAAGGAGG - Intronic
1002227215 5:177732394-177732416 CTGAGGTCAGATTAGGAAGGAGG - Intronic
1002266928 5:178041377-178041399 CTGAGGTCAGATTAGGAAGGAGG + Intronic
1002462916 5:179385011-179385033 CTGTGATGGGATTAGGAAGTGGG - Intergenic
1003311006 6:4969973-4969995 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1003402116 6:5799279-5799301 ATGTGATAATATTAAGAAGTGGG - Intergenic
1003435450 6:6083923-6083945 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1003518845 6:6840486-6840508 CTGTTTTCATTTTAGGAAGAGGG - Intergenic
1003674335 6:8189143-8189165 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1003946196 6:11078170-11078192 ATGTGATGGCATTAGGAAGTGGG + Intergenic
1003954190 6:11146861-11146883 CTGTGACCTTATTTGGAAATGGG + Intergenic
1004281066 6:14280374-14280396 CTGTGCTGGTATTAGGAGGTGGG - Intergenic
1004362009 6:14979584-14979606 CAGTCATCATATTTGGAAATAGG - Intergenic
1004470166 6:15921927-15921949 CTGTGATCTTATTTGGAAAAAGG + Intergenic
1004475574 6:15968148-15968170 ATGTGATCTTATTTGGAAGTAGG - Intergenic
1004593147 6:17073246-17073268 ATGTGATGATATTTGGAGGTGGG + Intergenic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1005082671 6:21972669-21972691 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1005121657 6:22396736-22396758 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1005129726 6:22492271-22492293 GTGTGATAGTATTAGGAGGTAGG + Intergenic
1005165042 6:22909944-22909966 ATGTGATCTTATTTGGAAATAGG + Intergenic
1005212021 6:23477136-23477158 ATGTGATAGTATTAGGAAGTGGG + Intergenic
1005224551 6:23626538-23626560 ATGTGATGATATTTGGAGGTGGG + Intergenic
1005583808 6:27257164-27257186 CTGTGATCATATTTGGAATCAGG - Intergenic
1005660656 6:27995823-27995845 ATGTGATGATATTAGGAGATGGG - Intergenic
1005878891 6:30038988-30039010 GTGAGATGATATTTGGAAGTGGG + Intergenic
1005980880 6:30835581-30835603 GTGTGATGATATTTGGAGGTGGG + Intergenic
1006017661 6:31095070-31095092 ATGTGATCTGATTAGGAAATAGG - Intergenic
1006915741 6:37592857-37592879 ATGTGATCTTATTTGGAAATAGG - Intergenic
1007952545 6:45885150-45885172 ATGTGATGGTATTAGGAAGTGGG + Intergenic
1007982586 6:46174160-46174182 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1008774353 6:55018257-55018279 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1008992293 6:57617356-57617378 ATGTGATCTTATTTGGAAATAGG - Intronic
1009026175 6:58002964-58002986 ATGTGATAGTATTTGGAAGTGGG + Intergenic
1009041783 6:58188989-58189011 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1009180917 6:60516468-60516490 ATGTGATCTTATTTGGAAATAGG - Intergenic
1009217632 6:60943252-60943274 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1009883195 6:69595077-69595099 ATGTGATCATATTTGGAATAGGG - Intergenic
1009987249 6:70795601-70795623 ATGTGATATTATTAGGAGGTGGG - Intronic
1010628566 6:78168898-78168920 ATGTGATGATATTAGGAGGTAGG + Intergenic
1011544290 6:88467129-88467151 ATGTGATCTTATTTGGAAATAGG + Intergenic
1011574901 6:88786834-88786856 ATGTGATGGTATTAGGAGGTGGG + Intronic
1011602776 6:89075335-89075357 GTGTGATAATGTTAGGACGTGGG - Intergenic
1011777015 6:90742190-90742212 ATGTGATCATATTTGGAGATAGG + Intergenic
1012108814 6:95199689-95199711 ATGTGGTCAGATTAGAAAGTAGG + Intergenic
1012181605 6:96161186-96161208 ATGTGATGATATTAAGAGGTGGG + Intronic
1012297956 6:97547947-97547969 GTGTGATAGTATTAGGATGTGGG - Intergenic
1012505558 6:99942509-99942531 ATGTGATCTTATTTGGAAATAGG - Intronic
1012785280 6:103617300-103617322 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1012853912 6:104478635-104478657 TTGTGATGGTATGAGGAAGTGGG - Intergenic
1013715346 6:112954513-112954535 ATGTGATGGTATTAGGATGTAGG + Intergenic
1013787646 6:113799617-113799639 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1013880557 6:114894365-114894387 ATTTGATGATATTAGGAGGTGGG - Intergenic
1014008115 6:116444601-116444623 ATGTGATAGTATTAGGATGTGGG + Intergenic
1014056656 6:117023954-117023976 TTGTGATCATATTTGGAGGTGGG + Intergenic
1014159843 6:118155332-118155354 CTGTGACAATATTAAGAGGTGGG + Intronic
1014469739 6:121799688-121799710 CTGTGACCATATTTGTAAATAGG + Intergenic
1015203492 6:130608669-130608691 GTGTGATGATATTTGGAGGTGGG - Intergenic
1015589629 6:134810544-134810566 ATGTGACCTTATTTGGAAGTAGG + Intergenic
1015869206 6:137759226-137759248 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1015948756 6:138530109-138530131 ATGTGATGGTATTAGGAGGTGGG + Intronic
1016050647 6:139526667-139526689 ATGTGATGGTATTTGGAAGTGGG + Intergenic
1016439805 6:144071273-144071295 AAGTGATGGTATTAGGAAGTGGG + Intergenic
1016460088 6:144272825-144272847 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1016646521 6:146415314-146415336 GTGTGATGATATTAGGAAGTGGG - Intronic
1016771807 6:147860342-147860364 ATGTGATCTTATTTGGAAATAGG - Intergenic
1016799366 6:148153264-148153286 GTGAGGTCATATGAGGAAGTAGG + Intergenic
1016876542 6:148871003-148871025 GTGTGATGATATTTGGAGGTGGG + Intronic
1017186984 6:151611577-151611599 CAATGATGATATTAAGAAGTGGG - Intronic
1017515349 6:155151467-155151489 AGGTGATGGTATTAGGAAGTGGG - Intronic
1017603993 6:156113427-156113449 CAGTGATTGTATTAGAAAGTGGG - Intergenic
1017803886 6:157926082-157926104 ATGTGATAATATTAAGAGGTGGG - Intronic
1017844463 6:158244449-158244471 ATGTGATAGTATTTGGAAGTGGG + Intronic
1017904290 6:158746196-158746218 ATGTGATGGTATTAGGAGGTAGG - Intronic
1018297196 6:162361304-162361326 ATGTGATCGTATTTGGAGGTAGG + Intronic
1018520559 6:164645547-164645569 GTGTGATGATATTGGGAGGTGGG + Intergenic
1019026816 6:168972718-168972740 GTGTGATAATATTTGGAGGTAGG - Intergenic
1020791054 7:12628557-12628579 GTGTGATGGTATTAGGAGGTGGG - Intronic
1020981047 7:15069585-15069607 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1021088175 7:16448720-16448742 ATGTGATAATATTAGGAAATAGG - Intergenic
1021254776 7:18377302-18377324 ATGTGATGGTATTAGGAGGTGGG - Intronic
1021365862 7:19776984-19777006 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1021409674 7:20315799-20315821 ATGTGATGATATTAAGAGGTGGG + Intergenic
1021623768 7:22572839-22572861 ATGTGATCTTATTTGGAGGTAGG - Intronic
1021824050 7:24530111-24530133 AGGTGATGATATTAGGAGGTGGG - Intergenic
1022002357 7:26237977-26237999 AGGTGATGATATTAGGATGTGGG + Intergenic
1022141226 7:27494642-27494664 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1022161385 7:27714523-27714545 GTGTGATGATATTAGGAGGAGGG - Intergenic
1022512234 7:30946138-30946160 ATGTGATGATATTAGGGGGTGGG + Intronic
1022609856 7:31859525-31859547 CTGTGAACATTTTAGGATATTGG - Intronic
1022610127 7:31862680-31862702 ATGTGATGGTATTAGGTAGTGGG - Intronic
1022796775 7:33738010-33738032 GTGTGATGGTATTAGGAGGTGGG + Intergenic
1022843055 7:34182839-34182861 GTGTGATGATATTAGGAGGTAGG + Intergenic
1022955136 7:35373801-35373823 ATGTGATGATATTAGGAGGTGGG - Intergenic
1022958459 7:35402463-35402485 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1023572663 7:41588464-41588486 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1023624217 7:42100345-42100367 ATGTGACCATATTTGGAAATAGG + Intronic
1023853950 7:44169357-44169379 GTGTGATGATATTAAGAGGTGGG + Intronic
1023886694 7:44362057-44362079 ATGTGATAATATTAAGAAGAAGG - Intergenic
1024451035 7:49543102-49543124 ATGTGATGGTATTAGGAAGTGGG + Intergenic
1024758766 7:52568575-52568597 ATGTGATGATATTTGGAGGTGGG - Intergenic
1024871948 7:53973727-53973749 ATGTGATAATATTAAGAGGTGGG - Intergenic
1024915136 7:54490621-54490643 CAGTGATAGTATTAGGAGGTGGG - Intergenic
1025109716 7:56203862-56203884 GTGTGATGATATTAGGAAGTGGG - Intergenic
1026308197 7:69160757-69160779 GTGTGATGATTTTAGGAAGTGGG + Intergenic
1026627595 7:72010172-72010194 TTGTGATGGTATTAGGAAGCGGG + Intronic
1026654252 7:72243095-72243117 ATGTGATGATATTTGGAAGTGGG + Intronic
1026818612 7:73531458-73531480 CTGTGATCGTATTAAGAGGTGGG - Intergenic
1027169252 7:75859190-75859212 ATGTGATCTTATTTGGAAGTAGG + Intronic
1027701567 7:81476381-81476403 ATGTGATGATATTAGGAGGTAGG - Intergenic
1027888458 7:83938994-83939016 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1028092955 7:86725978-86726000 GTGTGATGATATTTGGAGGTGGG - Intronic
1029892922 7:103950226-103950248 AAGTGATGGTATTAGGAAGTAGG - Intronic
1030150434 7:106399006-106399028 ATGTGGTCATATTTGGAAATAGG + Intergenic
1030318614 7:108141587-108141609 CTGTGATGGTATTAGGAGGTAGG + Intergenic
1030339625 7:108362331-108362353 GGGTGATGATATTAGGAAGTGGG - Intronic
1030755316 7:113280776-113280798 CTGTGATAACATTAGTATGTAGG - Intergenic
1030947496 7:115741870-115741892 ATGTGATGATATTTGGAAGTGGG - Intergenic
1031016180 7:116579037-116579059 AGGTGATGATATTAGGAGGTGGG - Intergenic
1031293556 7:119971343-119971365 TTGGGATCATTTTAAGAAGTAGG + Intergenic
1031305822 7:120125701-120125723 ATGTGATATTATTAAGAAGTGGG + Intergenic
1031461951 7:122062383-122062405 AGGTGATAATATTAGGAAGTAGG + Intergenic
1031749496 7:125554536-125554558 CCATGTTCAAATTAGGAAGTGGG + Intergenic
1032140675 7:129327132-129327154 GTGTGATGGTATTAGGAGGTGGG + Intronic
1032794326 7:135265650-135265672 CTCTGATGGTATTAGGAGGTGGG + Intergenic
1032864948 7:135915865-135915887 ATGTGATCTTATTTGGAAATAGG - Intergenic
1032881332 7:136093555-136093577 ATTTGATGGTATTAGGAAGTGGG - Intergenic
1032900013 7:136296499-136296521 ATGTGACCATATTTGGAAATAGG + Intergenic
1032928429 7:136636935-136636957 GTGTGATGGTATTTGGAAGTAGG - Intergenic
1033069112 7:138185829-138185851 ATGTGATCTTATTTGGAAATAGG - Intergenic
1033639273 7:143245642-143245664 AGGTGATGGTATTAGGAAGTGGG + Intronic
1033805066 7:144944565-144944587 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1033838697 7:145347440-145347462 ATGCGATGATATTAGGAGGTGGG + Intergenic
1033876363 7:145823388-145823410 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1033889329 7:145990279-145990301 ATGTGATATTATTAGGAGGTAGG + Intergenic
1034032489 7:147783660-147783682 ATGTGATGATATTAAGAAGTTGG + Intronic
1034209862 7:149354039-149354061 ATGTGATCTTATTTGGAAATAGG + Intergenic
1034672433 7:152868842-152868864 ATGTGACCTTATTTGGAAGTAGG - Intergenic
1034859073 7:154580966-154580988 CTGAGGTCACATTAGGAAGGTGG - Intronic
1034912683 7:155010345-155010367 GTGTGACCTTATTTGGAAGTAGG + Intergenic
1036041921 8:5094074-5094096 GTGTGATGATATTTGGAGGTGGG - Intergenic
1036067369 8:5397044-5397066 ATGTGATGATATTAGGAAGTAGG + Intergenic
1036110147 8:5889877-5889899 ATGTGATCGTATTAGAAGGTGGG - Intergenic
1036145103 8:6247685-6247707 ATGTGATGGTATTTGGAAGTAGG + Intergenic
1036591217 8:10170255-10170277 ATGTGATGATATCAGGAAGTGGG + Intronic
1036703449 8:11029385-11029407 ATGTGATGGTATTAGGAAATGGG + Intronic
1037105852 8:15107327-15107349 ATGTGATAATATTGGGAAGTAGG + Intronic
1037219069 8:16495224-16495246 TTGTAATGATATTAGGAGGTGGG + Intronic
1037436323 8:18867459-18867481 CTGTGATCATTTTAGTCTGTGGG - Intronic
1037732076 8:21534485-21534507 GTGTGATGAAATTAGAAAGTGGG - Intergenic
1037852172 8:22340435-22340457 ATGTGACCATATTTGGAAGCAGG + Intronic
1038358601 8:26854862-26854884 GTGTGATGATATTAGGAGATGGG + Intronic
1038368624 8:26963850-26963872 ATGTGCTAATATTAAGAAGTGGG - Intergenic
1038854544 8:31317186-31317208 ATGTGATAGTATTAGGAGGTAGG + Intergenic
1039029692 8:33295986-33296008 ATGTGATGATATTAGGAGGTGGG - Intergenic
1039594115 8:38775647-38775669 ATGTGAGAATATTAAGAAGTGGG - Intronic
1040389225 8:46935340-46935362 AAGTGATGGTATTAGGAAGTGGG + Intergenic
1040600686 8:48880837-48880859 CTGTGACCTTATTTGGAAGTAGG - Intergenic
1040852833 8:51919578-51919600 GTGTGATGATATTAGGAGGTGGG - Intergenic
1040871481 8:52104150-52104172 AGGTGATGATATTAGGAGGTGGG + Intergenic
1040949648 8:52924717-52924739 GTGTGATGATATTTGGAGGTGGG + Intergenic
1041040934 8:53845134-53845156 AGGTGATGATATTAGGAGGTGGG - Intergenic
1041049258 8:53916995-53917017 AGGTGATGATATTTGGAAGTGGG - Intronic
1041152591 8:54952121-54952143 CTGGGAGCAAATTAAGAAGTTGG - Intergenic
1041333957 8:56758827-56758849 ATGTGAAGATATTAGGAGGTGGG + Intergenic
1041436764 8:57850309-57850331 ATGTGATGATATGAGGACGTAGG - Intergenic
1041443656 8:57926737-57926759 CTGTGATGGTATTAGAAGGTGGG - Intergenic
1041483541 8:58349233-58349255 ATGTGATGGTATTAGGAAGTAGG + Intergenic
1041517260 8:58714240-58714262 CTGTGATGATATTAGAAGGTGGG + Intergenic
1041777976 8:61545158-61545180 ATGTGATGGTGTTAGGAAGTGGG + Intronic
1041802451 8:61814513-61814535 ATGTGATCTTATTTGGAAATAGG + Intergenic
1041872743 8:62653401-62653423 ATGTGATGATATTTGGAGGTGGG - Intronic
1042181782 8:66096310-66096332 ATGTGATCATATTTGGAGATAGG - Intronic
1042221317 8:66477534-66477556 ATGTGATGGTATTAGGAAGTGGG + Intronic
1042342315 8:67693530-67693552 ATGTGATGGTATTAGGAAATGGG + Intronic
1042628700 8:70791446-70791468 TTGTAATAATATTAAGAAGTAGG + Intergenic
1042735530 8:71983676-71983698 GTGTGATAATATTTGAAAGTGGG + Intronic
1042775762 8:72429237-72429259 ATGTGACCTTATTAGGAAATAGG + Intergenic
1042820203 8:72922325-72922347 GTGTGATCTTATTTGGAAATGGG - Intronic
1042865408 8:73352667-73352689 ATGTGATGATATGAGGATGTGGG + Intergenic
1042928987 8:73994998-73995020 TTGTGATGATATTAAGAGGTGGG + Intronic
1042970932 8:74408393-74408415 GTGTGATGGCATTAGGAAGTGGG + Intronic
1042984969 8:74573501-74573523 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1043431823 8:80202176-80202198 ATGTGATAGTATTAAGAAGTGGG + Intronic
1043500049 8:80844477-80844499 GTGTGATGGTATTAGGAGGTAGG - Intronic
1043715613 8:83481847-83481869 ATGTGATGGTATTAGAAAGTAGG + Intergenic
1044301068 8:90583717-90583739 ATGTGATCTTATTTGGAAATAGG - Intergenic
1044423186 8:92022449-92022471 ATGTGATAATATTAAGAACTGGG + Intronic
1044745449 8:95366439-95366461 GTGTGATCATATTTGGAGATAGG - Intergenic
1044760386 8:95511454-95511476 TTGTGATGATATTAAGAAGTAGG + Intergenic
1045142015 8:99296652-99296674 ATGTGATAATATTAGGAAGTGGG + Intronic
1045778783 8:105838980-105839002 CAGTGATGATATTAGGAAATGGG + Intergenic
1045859784 8:106803205-106803227 ATGTGATGATACTAGGAGGTGGG - Intergenic
1045876572 8:106988731-106988753 CAGTAATCATTTGAGGAAGTAGG + Intergenic
1046167938 8:110463564-110463586 CTGTGATCATATTTGAGAGAAGG - Intergenic
1046226792 8:111292250-111292272 ATGTGATCTTATTTGGAGGTAGG + Intergenic
1046357839 8:113111051-113111073 TAGTGATGATATTAGGAGGTTGG - Intronic
1046616307 8:116481293-116481315 CTGTGACGGTATTAGGAGGTGGG - Intergenic
1046886147 8:119369367-119369389 ATGTGATTATATTTGGAGGTGGG + Intergenic
1047032974 8:120903539-120903561 CTGTGATAGTATTAGCAAGTGGG + Intergenic
1047053265 8:121137256-121137278 GTGTGTTGGTATTAGGAAGTGGG + Intergenic
1047202174 8:122776324-122776346 ATGTGATCATATTAGGAAGTGGG - Intergenic
1047324638 8:123824649-123824671 ATGTGACCTTATTTGGAAGTGGG + Intergenic
1047348458 8:124050846-124050868 ATGTGATGGTATTTGGAAGTGGG - Intronic
1047388050 8:124427639-124427661 ATGTGATCTTATTTGGAAATGGG - Intergenic
1047437174 8:124844388-124844410 ATGTGATCATATTTGGAAATAGG + Intergenic
1047600236 8:126418873-126418895 CTGTGACCTTATTTGGAAATAGG + Intergenic
1047962581 8:130021616-130021638 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1048206573 8:132420236-132420258 GTGTGATAGTATTAGGAGGTGGG - Intronic
1048489681 8:134881037-134881059 ATGTGATGTTATTAGGAGGTAGG + Intergenic
1050014816 9:1222331-1222353 ATGTGATGGTATTAAGAAGTGGG + Intergenic
1050073856 9:1843621-1843643 ATGTGATGATATTTGGAGGTGGG + Intergenic
1050425602 9:5509614-5509636 ATGTGACTATATTTGGAAGTAGG + Intergenic
1050665547 9:7932281-7932303 AGGTGATGATATTAGGAGGTGGG - Intergenic
1050696373 9:8283741-8283763 ATGTGATAATATTAGGAGGTGGG - Intergenic
1050983367 9:12049431-12049453 CTGTGATGGTATTAGAAGGTGGG - Intergenic
1051054656 9:12970736-12970758 ATGTGACCATATTTGGAAATAGG - Intergenic
1051127784 9:13823704-13823726 AGGTGATTATATTAGGAAATAGG - Intergenic
1051234879 9:14989496-14989518 CTGTGACCTTATTTGGAAATAGG + Intergenic
1051277351 9:15409356-15409378 ATGTGAAGATATTAGGAAATGGG - Intergenic
1051297504 9:15611900-15611922 TTGTGATGGTATTAGGAGGTGGG + Intronic
1051662663 9:19440386-19440408 AGGTGATGATATTAGGAGGTGGG + Intronic
1052234520 9:26193999-26194021 ATGTGATGATATTTGGAAGGTGG + Intergenic
1052622392 9:30930311-30930333 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1052932487 9:34067144-34067166 CTGAGACTATATTAGGTAGTGGG + Intergenic
1053359438 9:37473778-37473800 GTGTGATGGTATTAGGAGGTGGG + Intergenic
1053646562 9:40123330-40123352 ATGTGATGATATTTGGAGGTAGG - Intergenic
1053759152 9:41340221-41340243 ATGTGATGATATTTGGAGGTAGG + Intergenic
1054327575 9:63721232-63721254 ATGTGATGATATTTGGAGGTAGG - Intergenic
1054538008 9:66252643-66252665 ATGTGATGATATTTGGAGGTAGG + Intergenic
1054910287 9:70449048-70449070 GTGTGATGATATTTGGAGGTGGG + Intergenic
1054999643 9:71434249-71434271 AGGTGATGATATTAGGAGGTGGG + Intronic
1055570395 9:77610549-77610571 ATGTGATGATATTTGGAAGTGGG - Intronic
1055653377 9:78430192-78430214 GTGTGATGGTATTTGGAAGTGGG + Intergenic
1055828378 9:80353734-80353756 ATGTGATGTTATTAGGAGGTTGG - Intergenic
1055860911 9:80747872-80747894 ATGTGATAATTTTAAGAAGTGGG + Intergenic
1056035651 9:82602082-82602104 CTCAGATCATTTTTGGAAGTGGG + Intergenic
1056423498 9:86453320-86453342 AGGTGATCGTATTAGGAGGTGGG - Intergenic
1056469936 9:86895449-86895471 GTGTGATCGTATTAAGGAGTGGG + Intergenic
1056526963 9:87452385-87452407 CGGTGATGGTATTAGGAGGTAGG + Intergenic
1056700417 9:88901086-88901108 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1057056258 9:91963585-91963607 ATGTGATAGTGTTAGGAAGTGGG + Intergenic
1057082331 9:92182097-92182119 GTGTGACCTTATTCGGAAGTAGG - Intergenic
1057289869 9:93798724-93798746 ATGTGATAATATTTGGAGGTAGG + Intergenic
1057540254 9:95961167-95961189 ATGTGATCTTATTTGTAAGTAGG + Intronic
1057706347 9:97397797-97397819 ATGTGATAATATTAGGAGGTGGG - Intergenic
1057957359 9:99421853-99421875 AGGTGATGGTATTAGGAAGTGGG + Intergenic
1057958069 9:99427552-99427574 ATGTGATTATGTTAGGAAGATGG + Intergenic
1058023748 9:100117796-100117818 ATGTGATGATATTAGGAGGCGGG + Intronic
1058076269 9:100655135-100655157 GTGTGATGGTATTAGGAGGTGGG - Intergenic
1058109597 9:101017860-101017882 TTGTGATAATATTAAGAGGTAGG - Intergenic
1058116727 9:101092786-101092808 CTGTGATGGTATTAGGAGGTGGG + Intronic
1058339542 9:103877878-103877900 GTGTGGTAATATTAGGAGGTGGG - Intergenic
1058377589 9:104341517-104341539 GTGTGATAATATTAAGAGGTGGG + Intergenic
1058395541 9:104549405-104549427 GTGTGATGATATTGGGAAGTGGG + Intergenic
1058850312 9:109005428-109005450 ATGTGATGGTATTAGGAGGTGGG + Intronic
1058890715 9:109358408-109358430 ATGTGATGGCATTAGGAAGTGGG + Intergenic
1058917509 9:109581825-109581847 ATGTAATGATATTAGGAGGTGGG - Intergenic
1059521300 9:114944634-114944656 ATGTGATGATATTTGGAGGTAGG - Intergenic
1059544333 9:115161078-115161100 ATGTGATGGTATTAGGAGGTGGG + Intronic
1059553122 9:115250463-115250485 GTGTGATGGTATTTGGAAGTGGG + Intronic
1059553390 9:115252935-115252957 ATGTGATGGTATTTGGAAGTGGG + Intronic
1059983032 9:119794205-119794227 ATGTGATAGTATTAGGATGTGGG + Intergenic
1060001793 9:119965442-119965464 ATGTGATCTTATTTGGAAATAGG + Intergenic
1060056564 9:120419007-120419029 ATGTAATGGTATTAGGAAGTGGG + Intronic
1060146034 9:121253174-121253196 ATGTGATGCTATTTGGAAGTGGG - Intronic
1061915871 9:133753555-133753577 ATGTGATCGTATTTGGAAATAGG - Intergenic
1062141949 9:134964112-134964134 CTGTGATCGTATTTGGAGGTAGG - Intergenic
1062177829 9:135174138-135174160 ATGTGATCTTATTTGGAAATGGG - Intergenic
1062258371 9:135642759-135642781 ATGTGATCTTATTTGGAAATCGG - Intergenic
1202794350 9_KI270719v1_random:106765-106787 ATGTGATGATATTTGGAGGTAGG - Intergenic
1185721805 X:2388320-2388342 ATGTGATCATATTTGGATATGGG + Intronic
1185811849 X:3117877-3117899 CATTTATCATATTAGGAATTTGG - Intergenic
1185843414 X:3414706-3414728 CTGTAATGATTTTAGAAAGTGGG + Intergenic
1185937666 X:4276931-4276953 CAGTGATCATATCAGGTAATTGG - Intergenic
1186109319 X:6239125-6239147 ATATGATAATATTAAGAAGTAGG - Intergenic
1186530637 X:10291629-10291651 CTGTAATGGTATTAGGAGGTAGG - Intergenic
1186745929 X:12568925-12568947 TTGTGATCGTATTAAGAGGTAGG + Intronic
1186836221 X:13441122-13441144 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1186981199 X:14959448-14959470 ATGTGATCATTTTAAGAGGTAGG - Intergenic
1187257894 X:17657889-17657911 CTATGAACACAGTAGGAAGTTGG - Intronic
1187316695 X:18202398-18202420 ATGTGATCGTATTAAGAAATGGG + Intronic
1187420632 X:19130645-19130667 ATGTGATAGTATTAGGGAGTGGG + Intergenic
1187591221 X:20719563-20719585 ATGTGATCTGATTTGGAAGTAGG - Intergenic
1187677556 X:21732798-21732820 ATGTGATAATATTAGGAGGTGGG + Intronic
1187823749 X:23314602-23314624 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1188290670 X:28383955-28383977 ATGTGATCTTATTTGGAAATAGG - Intergenic
1188622224 X:32240285-32240307 AGGTGATGACATTAGGAAGTGGG + Intronic
1188750504 X:33899137-33899159 ATGTGACCTTATTTGGAAGTCGG + Intergenic
1188753489 X:33932379-33932401 ATGTGATGATATTTGGAGGTGGG - Intergenic
1188953707 X:36408447-36408469 ATGTGACCATATTTGGAGGTAGG - Intergenic
1189074174 X:37898270-37898292 ATGTGATAGTATTAGGAGGTGGG - Intronic
1189136765 X:38558652-38558674 ATGTGATCTTATTTGGAAATAGG - Intronic
1189232223 X:39461349-39461371 ATGGGATGATATTAGGAGGTGGG + Intergenic
1189249254 X:39587405-39587427 CTGTGACCTTATTTGGAAGTAGG - Intergenic
1189366880 X:40395643-40395665 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1189548830 X:42072193-42072215 AAGTGATGGTATTAGGAAGTAGG + Intergenic
1189554222 X:42125623-42125645 ATGTGATAGTATTAGAAAGTAGG - Intergenic
1189633799 X:42983404-42983426 TTGTAATCATATTAAGAGGTGGG + Intergenic
1189745595 X:44165782-44165804 ATGTGATGATATTAGGAGTTGGG + Intronic
1190224093 X:48532451-48532473 GTGTAATGATATTAGGAGGTGGG - Intergenic
1190226127 X:48546602-48546624 ATGTGATCATATTAAGAGGTGGG - Intronic
1190242429 X:48667920-48667942 ATATAATCATATTAGGAGGTGGG - Intergenic
1190372034 X:49751978-49752000 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1190434413 X:50409040-50409062 CTGTGATTCTATATGGAAGTAGG + Intronic
1190950050 X:55134626-55134648 ATGTGATGGTATTAGGAGGTGGG - Intronic
1191681987 X:63850452-63850474 TTGTGATGGTATTAGGAGGTGGG + Intergenic
1192070575 X:67936245-67936267 CAGTGAACCTATTGGGAAGTGGG + Intergenic
1192094674 X:68198158-68198180 ATGTGATGATATTAAGAAATGGG + Intronic
1192374159 X:70542138-70542160 AGGTGATGATATTAGGAGGTGGG + Intronic
1192826936 X:74707108-74707130 ATGTGACCATATTTGGAAATAGG + Intergenic
1193272634 X:79546689-79546711 ATGTGATAATATTAAGAAGTGGG - Intergenic
1193533016 X:82678996-82679018 ATGTGATGATATTTAGAAGTGGG + Intergenic
1194250277 X:91566188-91566210 AGGTGATCAGATCAGGAAGTTGG + Intergenic
1194314423 X:92357451-92357473 AGGTGATAGTATTAGGAAGTGGG + Intronic
1194461881 X:94180322-94180344 ATGTGATAATATTAAGAGGTGGG + Intergenic
1194514488 X:94834661-94834683 GTGTGATCATATTTGGAAATGGG - Intergenic
1194675950 X:96793733-96793755 ATGTGATTGTATTAGGAGGTGGG - Intronic
1194818015 X:98469102-98469124 ATGTGATGATATTAGCAGGTGGG - Intergenic
1195090613 X:101455003-101455025 GTGTGATAATATTAGGAGGTGGG - Intronic
1195748317 X:108139990-108140012 GTATGATGGTATTAGGAAGTGGG - Intronic
1196666055 X:118317950-118317972 ATGTGATGGTATTTGGAAGTGGG + Intergenic
1196760507 X:119196821-119196843 ATGTGATAATATTATGAGGTGGG - Intergenic
1196873911 X:120139493-120139515 ATGTGATTGTATTAGAAAGTGGG + Intergenic
1196964332 X:121039266-121039288 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1197013160 X:121591726-121591748 ATGTGATGATGTTAGGAGGTGGG + Intergenic
1197037461 X:121892192-121892214 ATGTGATAGTATTAGGAAGTGGG + Intergenic
1197168696 X:123407635-123407657 AGGTGATGGTATTAGGAAGTGGG - Intronic
1197405749 X:126046955-126046977 ATGTGATGATATTAGGAGGTGGG + Intergenic
1197459978 X:126729223-126729245 CTGTGATGATCTGAGGAATTAGG - Intergenic
1197532799 X:127651092-127651114 ATGTGATGGTATTAGGAAATGGG - Intergenic
1197606174 X:128588076-128588098 ATGTGATGCTATTAGGAGGTGGG + Intergenic
1197925430 X:131642363-131642385 ATGTGTTGATATTAGGAGGTGGG - Intergenic
1198409832 X:136355331-136355353 GTGTGATTATATTAGGAGGCGGG - Intronic
1198601124 X:138285295-138285317 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1198659293 X:138949572-138949594 ATGTGATCTTATTTGGAAATAGG - Intronic
1198772859 X:140149484-140149506 GTGTGATGGCATTAGGAAGTGGG + Intergenic
1198793441 X:140370702-140370724 ATGTGATGGTATGAGGAAGTGGG + Intergenic
1199020588 X:142872589-142872611 ATGTGATGTTATTAGGAGGTGGG + Intergenic
1199026323 X:142942888-142942910 ATGGGATGATATTAGGATGTGGG + Intergenic
1199045813 X:143170288-143170310 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1199130219 X:144176219-144176241 ATGTGATGGTATTAGGAGGTAGG - Intergenic
1199253955 X:145697576-145697598 ATGTGACCTTATTAGGAAGTAGG - Intergenic
1199474057 X:148226918-148226940 ATGTGATCTTATTTGGAAATAGG + Intergenic
1199697741 X:150355089-150355111 ATGTGATCTTATTTGGAAATAGG + Intergenic
1199706154 X:150427204-150427226 ATGTGATCTTATTTGGAAATAGG - Intronic
1199748354 X:150790914-150790936 ATGTGATGATATTAGGAGGTGGG + Intronic
1199762458 X:150915606-150915628 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1199877706 X:151947908-151947930 ATGTGAGAATATTTGGAAGTGGG + Intergenic
1199945464 X:152662522-152662544 ATGTGATAATATTAAGAGGTGGG - Intergenic
1200050940 X:153431357-153431379 ATGTGATCATGTTTGGAAGTAGG + Intergenic
1200203970 X:154302678-154302700 ATGTGATCTTATTTGGAAATAGG + Intronic
1200374435 X:155765108-155765130 ATATGATAATATTAGGAGGTGGG - Intergenic
1200569235 Y:4807433-4807455 AGGTGATCAGATCAGGAAGTTGG + Intergenic
1200622481 Y:5468981-5469003 AGGTGATAGTATTAGGAAGTGGG + Intronic
1200756107 Y:6991492-6991514 CTGTGAGCTTATTTGGAGGTGGG + Intronic
1201269443 Y:12240479-12240501 CATTTATCATATTAGGAATTTGG + Intergenic
1201624678 Y:16001840-16001862 GTGTGATGAGATTAGGAGGTGGG - Intergenic
1202363737 Y:24139418-24139440 ATGTGATGATATTAAGAGGTAGG - Intergenic
1202507043 Y:25530699-25530721 ATGTGATGATATTAAGAGGTAGG + Intergenic