ID: 1080785554

View in Genome Browser
Species Human (GRCh38)
Location 11:35472055-35472077
Sequence AAGTAAACACTGATGAAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080785554_1080785557 5 Left 1080785554 11:35472055-35472077 CCGAGTTTCATCAGTGTTTACTT 0: 1
1: 0
2: 0
3: 24
4: 354
Right 1080785557 11:35472083-35472105 AGGGTTGATCACAGAGCTTTTGG 0: 1
1: 0
2: 1
3: 12
4: 145
1080785554_1080785560 13 Left 1080785554 11:35472055-35472077 CCGAGTTTCATCAGTGTTTACTT 0: 1
1: 0
2: 0
3: 24
4: 354
Right 1080785560 11:35472091-35472113 TCACAGAGCTTTTGGGGTGTAGG 0: 1
1: 0
2: 2
3: 20
4: 227
1080785554_1080785558 6 Left 1080785554 11:35472055-35472077 CCGAGTTTCATCAGTGTTTACTT 0: 1
1: 0
2: 0
3: 24
4: 354
Right 1080785558 11:35472084-35472106 GGGTTGATCACAGAGCTTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 147
1080785554_1080785559 7 Left 1080785554 11:35472055-35472077 CCGAGTTTCATCAGTGTTTACTT 0: 1
1: 0
2: 0
3: 24
4: 354
Right 1080785559 11:35472085-35472107 GGTTGATCACAGAGCTTTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080785554 Original CRISPR AAGTAAACACTGATGAAACT CGG (reversed) Intronic
901138278 1:7011628-7011650 AAGTAGACAGGGATGAAGCTGGG - Intronic
903567972 1:24283417-24283439 AAGTAAACATTGATTCACCTGGG + Intergenic
906804538 1:48767645-48767667 AAGAAACCACAGAAGAAACTAGG + Intronic
907777810 1:57535888-57535910 AAGATAAAACTGATGAAAATGGG + Intronic
909459458 1:75893441-75893463 AGGGAGACACTGATGAACCTGGG + Intronic
909771426 1:79427076-79427098 AAATAAACACAGAAGAGACTAGG + Intergenic
911806522 1:102215548-102215570 AGGCAAAAACTGATAAAACTGGG + Intergenic
911817968 1:102378275-102378297 ATGTAAACATTGAGGGAACTTGG + Intergenic
911843770 1:102721295-102721317 AAAAAAACACTGTTGAAATTGGG - Intergenic
912781519 1:112553208-112553230 AAGAAAAGATTGATAAAACTGGG - Intronic
912881265 1:113417948-113417970 AAAGAAAAACTGATAAAACTTGG - Intronic
913216168 1:116622502-116622524 AACAAAACATTGATGATACTGGG + Intronic
916682142 1:167114465-167114487 AAGTGCACACTGATGAAGCAGGG + Intronic
917108554 1:171520433-171520455 ATATAATCACTGATGAAAGTGGG - Intronic
917250820 1:173058746-173058768 AAATAAACACTTAAGAAATTTGG - Intergenic
917559028 1:176125331-176125353 AAGAAAACATTGGGGAAACTTGG - Intronic
918671875 1:187227841-187227863 AAGCGAACACTGATGAAGCCAGG + Intergenic
918841905 1:189551911-189551933 AGGTAAAAACTAAGGAAACTTGG - Intergenic
919005851 1:191898349-191898371 AAGGAATCAGTGAAGAAACTGGG - Intergenic
919664541 1:200279408-200279430 AAGTAAATAAAGATGAAATTTGG + Intergenic
920194320 1:204216853-204216875 AATTAAACGCTCATGATACTGGG + Intergenic
920773868 1:208916483-208916505 AAGTAGATACTTATGAAAATGGG + Intergenic
921772440 1:219057550-219057572 ACAAAAACACTGATCAAACTAGG + Intergenic
922628655 1:227081392-227081414 AAGTAATCATTGTTGAAATTAGG - Intronic
1064062482 10:12149838-12149860 TACCAAACACTGATGAAAGTTGG - Exonic
1064584266 10:16823537-16823559 AGGTAAACACAGGTGAGACTTGG + Intergenic
1064879359 10:20032973-20032995 AAGTAAACAATGAGAACACTTGG + Intronic
1065670400 10:28110006-28110028 AAGAAACCACTGAAGAAAGTTGG - Intronic
1067453921 10:46400216-46400238 ACGTAAACAGTGGAGAAACTGGG + Intergenic
1067583274 10:47459058-47459080 ATGTAAACAGTGGAGAAACTGGG - Intergenic
1067633280 10:47984411-47984433 ACGTAAACAGTGGAGAAACTGGG - Intergenic
1068971106 10:62959417-62959439 AAGTAAGCTCTAATGAAACCTGG + Intergenic
1070910365 10:80112561-80112583 GAGAAAACAATCATGAAACTGGG + Intergenic
1071544288 10:86516445-86516467 AAGTAAACACAGACAAAACTTGG - Intronic
1073405963 10:103298327-103298349 AAGGAAGAACTGTTGAAACTAGG + Intergenic
1073946577 10:108757530-108757552 AAGTCAATTCTGATGAAACAAGG - Intergenic
1074979984 10:118611654-118611676 AAGGAAACACTGGGGGAACTGGG + Intergenic
1074988268 10:118677308-118677330 AAGTATAAACAGATGAAAATAGG - Exonic
1075190514 10:120302911-120302933 AAGTAACCACAGATTAGACTAGG + Intergenic
1075366030 10:121890457-121890479 AACTAACAACTGTTGAAACTAGG + Intronic
1075872105 10:125778402-125778424 AAGGAAACACTCAGGAAAGTGGG - Intergenic
1076355257 10:129847986-129848008 AAGTAATCACAGATCAGACTGGG + Intronic
1077758865 11:5068198-5068220 TAGTCACCACTGATGAAATTAGG + Intergenic
1077971004 11:7190052-7190074 AAATAAACAGTGATGAAAACAGG + Intergenic
1078126050 11:8564595-8564617 AAGAAAAGACTGAAGGAACTTGG + Intronic
1078765466 11:14292766-14292788 AAATGTCCACTGATGAAACTTGG - Intronic
1079841787 11:25411408-25411430 AAATAAACACTAAAGCAACTAGG + Intergenic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1083373491 11:62201101-62201123 CGGTAAACAGTGATGAAAATAGG + Intergenic
1086511648 11:87564991-87565013 AAGTAAGCAATCATGAAAGTGGG - Intergenic
1086551405 11:88056934-88056956 CAGGAATCACTGAAGAAACTGGG - Intergenic
1088412019 11:109544653-109544675 ATGTAAGCAATAATGAAACTTGG + Intergenic
1088970021 11:114765691-114765713 AGGTATACACAGATGAAAGTAGG - Intergenic
1089904092 11:122020162-122020184 AAGTAATCCCTGAAGGAACTGGG - Intergenic
1091444781 12:538253-538275 TAGTAAACAGTGATCAAAATTGG + Intronic
1092313066 12:7379417-7379439 AATTAAACACTGGTGAAGCCGGG - Intronic
1093568660 12:20639770-20639792 AAGAGAACAGTGGTGAAACTAGG - Intronic
1093754336 12:22835334-22835356 ACATGAACACTGATGACACTAGG + Intergenic
1094304470 12:29002051-29002073 AAAGAAACACAGATGGAACTAGG + Intergenic
1094426262 12:30320328-30320350 AGATAAACACAGATGAAAATAGG + Intergenic
1096872057 12:54599149-54599171 GAGTGAACAAGGATGAAACTGGG + Intergenic
1096884476 12:54702671-54702693 GATTAAACACTAATGAAAGTGGG - Intergenic
1096938787 12:55317255-55317277 AAATAAACCCTGATGAAATAAGG + Intergenic
1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG + Intergenic
1098185042 12:67887791-67887813 ATGTTAGCACTGAGGAAACTAGG + Intergenic
1098557146 12:71832076-71832098 AAAGAAACACTGAACAAACTAGG - Intergenic
1098670738 12:73227306-73227328 AAGTAAACACTTTTGAAAGTAGG - Intergenic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1099145324 12:79036193-79036215 AAATGAGCATTGATGAAACTGGG + Intronic
1100816225 12:98389856-98389878 AATTAAAGCCTGATGAAACATGG - Intergenic
1101055444 12:100907749-100907771 AAGGAAGCACTGAAGACACTAGG - Intronic
1101093422 12:101311439-101311461 AAAGGCACACTGATGAAACTGGG - Intronic
1101437995 12:104680404-104680426 AAGGAAACCCTGATGAATGTGGG + Intronic
1101616053 12:106338366-106338388 AACTAAACACTGAGTAAACATGG - Intronic
1102515441 12:113443147-113443169 GAGTGAACACTAATGAAATTGGG - Intergenic
1102642815 12:114381828-114381850 AACTAACCACTGATGAAGTTGGG - Intronic
1102718097 12:114991767-114991789 AAATAAACACTGATGTATTTAGG - Intergenic
1103503227 12:121421568-121421590 AACTATACATTGATGAAATTTGG + Intronic
1104743775 12:131197477-131197499 AAGTTACCACTGGGGAAACTGGG - Intergenic
1105219905 13:18315981-18316003 AACAAAACATTGATGATACTGGG + Intergenic
1105333470 13:19440432-19440454 AAAAAAACACTCAAGAAACTAGG + Intronic
1105630480 13:22159205-22159227 AAACAAAAACTGAAGAAACTGGG + Intergenic
1106345751 13:28875919-28875941 ATTTAAACATTGATGAGACTTGG + Intronic
1106466964 13:30022273-30022295 AAGCAAACACTAGTGGAACTTGG - Intergenic
1107487479 13:40843204-40843226 AAAAAAACACTCAAGAAACTAGG + Intergenic
1108300446 13:49068998-49069020 AAGTAAACACTGATGTCACGGGG - Intronic
1108527888 13:51301257-51301279 ATGTAAACACTGTGGAATCTGGG - Intergenic
1108626977 13:52239494-52239516 CAATAAACACTCAAGAAACTAGG + Intergenic
1108659088 13:52566967-52566989 CAATAAACACTCAAGAAACTAGG - Intergenic
1109351805 13:61192154-61192176 AAGGAAACCCATATGAAACTGGG - Intergenic
1109940407 13:69356155-69356177 AAGTACACACTGCAGAAATTTGG - Intergenic
1109962862 13:69655286-69655308 AAGTAAACAATGAGAACACTTGG - Intergenic
1113116969 13:106884801-106884823 AAGTAAACAGTGAAAAAAATAGG + Intergenic
1113253333 13:108479188-108479210 AAGTATACACTGGTTAATCTGGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1114046073 14:18877081-18877103 GAGAAAACAATCATGAAACTGGG + Intergenic
1114118141 14:19642383-19642405 GAGAAAACAATCATGAAACTGGG - Intergenic
1114594725 14:23901664-23901686 AAACAAACACTGACGAGACTAGG + Intergenic
1114856927 14:26458606-26458628 AACTAAACACTGAGTAAACATGG + Intronic
1114956733 14:27830255-27830277 ATGTAACCACTGGGGAAACTAGG - Intergenic
1116368749 14:44103482-44103504 AAGTAATCAATGGGGAAACTGGG + Intergenic
1116421779 14:44741607-44741629 AAGAAAACACTGCTGACATTAGG - Intergenic
1116558905 14:46351719-46351741 AAGAAAACACTTATCAAAATGGG + Intergenic
1117274913 14:54183290-54183312 AAGAAGAAACTGATGTAACTGGG + Intergenic
1117483274 14:56169644-56169666 AAGTAAGCACTGATAATACCTGG - Intronic
1119639385 14:76303290-76303312 AAGGAAAGACTGAGGAAACGAGG - Intergenic
1121403082 14:93698847-93698869 AAGTCAAGACTTATCAAACTGGG + Intronic
1123715509 15:23027218-23027240 ATGTAAACTATGAGGAAACTGGG + Exonic
1124106764 15:26745365-26745387 ATGTAAACACTGAGAAAACTGGG - Intronic
1126584830 15:50274093-50274115 AATTAAAAACTGAGGAAGCTAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127565200 15:60181155-60181177 AGGTAAACACTGAAGAAATGTGG + Intergenic
1128433100 15:67618771-67618793 AAGAAAACAGTGATGAAAGGTGG - Intronic
1129049864 15:72771897-72771919 AAATAAAAAATGATTAAACTTGG - Intronic
1129616710 15:77104657-77104679 AAGAAGCCACTGATGATACTGGG + Exonic
1130817665 15:87455599-87455621 TAGAAAACAATGATGAATCTGGG - Intergenic
1132212157 15:100032175-100032197 AAGTAACCAGTGATGCAAGTTGG - Intronic
1135013674 16:18906065-18906087 AAGTAAACACTGGAGGACCTGGG - Intronic
1135320617 16:21493634-21493656 AAGTAAACACTGGAGGACCTGGG - Intergenic
1135373452 16:21925124-21925146 AAGTAAACACTGGAGGACCTGGG - Intergenic
1135438337 16:22445578-22445600 AAGTAAACACTGGAGGACCTGGG + Intergenic
1136330831 16:29575333-29575355 AAGTAAACACTGGAGGACCTGGG - Intergenic
1136445466 16:30315061-30315083 AAGTAAACACTGGAGGACCTGGG - Intergenic
1136532049 16:30876292-30876314 AAATAACCACGGATGAATCTGGG + Intronic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140548633 16:75838010-75838032 CACTCAGCACTGATGAAACTTGG - Intergenic
1140710055 16:77669306-77669328 AAGTGAACACTTATGATACCAGG + Intergenic
1141938580 16:87258869-87258891 AGGAAAAAACTGATAAAACTGGG + Intronic
1142168654 16:88608062-88608084 AAACAAACAATGAAGAAACTTGG - Intronic
1144552684 17:16255085-16255107 AAATAAAAACTGAGGAAAGTGGG - Intronic
1144878612 17:18418601-18418623 AACTGAACACTGATGCTACTTGG + Intergenic
1144885141 17:18452639-18452661 AACTGAACACTGATGCTACTTGG - Intergenic
1145147076 17:20491738-20491760 AACTGAACACTGATGCTACTTGG + Intergenic
1145177037 17:20709485-20709507 AACTGAACACTGATGCTACTTGG - Intergenic
1145177146 17:20710831-20710853 AACTGAACACTGATGCTACTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146853230 17:36241386-36241408 AACTAAACACTGATGCTACTTGG - Intronic
1146869138 17:36365276-36365298 AACTAAACACTGATGCTACTTGG - Intronic
1147058647 17:37855522-37855544 AACTAAACACTGATGCTACTTGG + Intergenic
1147072012 17:37965907-37965929 AACTAAACACTGATGCTACTTGG - Intergenic
1147083538 17:38045439-38045461 AACTAAACACTGATGCTACTTGG - Intronic
1147099484 17:38169406-38169428 AACTAAACACTGATGCTACTTGG - Intergenic
1147301692 17:39534116-39534138 AAGAAAAAACTAAGGAAACTGGG - Exonic
1147842716 17:43383377-43383399 AAGCAAGCACATATGAAACTAGG + Intergenic
1148995240 17:51703707-51703729 GAGGAAACACTTAGGAAACTGGG + Intronic
1149064167 17:52460525-52460547 AAGTGAACAATGAGAAAACTTGG + Intergenic
1149095890 17:52840129-52840151 AGCTAAAAACTGAAGAAACTTGG + Intergenic
1150082497 17:62252694-62252716 AACTAAACACTGATGCTACTTGG - Intergenic
1150696801 17:67412327-67412349 AAGTAGATACTGACAAAACTAGG + Intronic
1155489307 18:26383698-26383720 AAGAAAACACTGATGTGACACGG - Intronic
1155557677 18:27039062-27039084 AAGTAAATAATGATGAAATCTGG + Intronic
1155704162 18:28787379-28787401 AGCTAAACCCTCATGAAACTGGG - Intergenic
1156856587 18:41789398-41789420 AGGTGAATACTGATGAAAATGGG + Intergenic
1156884207 18:42115375-42115397 ATGTTAACAATGAGGAAACTTGG - Intergenic
1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG + Intergenic
1157495391 18:48153562-48153584 AAGAAAACATGGATGAAACATGG + Intronic
1157908405 18:51591303-51591325 AAGTAAAAATTGATGAAAGCAGG - Intergenic
1158081539 18:53598176-53598198 AAATTAAAACTGATGAGACTCGG + Intergenic
1158919020 18:62168550-62168572 AAGTAAACACTGAAGTATTTAGG - Intronic
1159719206 18:71865189-71865211 AAGAAAACCCTCAAGAAACTGGG - Intergenic
1160152822 18:76407817-76407839 AAGTGAACACTGTGGAAACTTGG - Intronic
1160321479 18:77900198-77900220 AAGTAGCCACAGAGGAAACTGGG + Intergenic
1161603094 19:5197244-5197266 AAATAAACACTCAGCAAACTAGG - Intronic
1164504082 19:28843802-28843824 ATATAAACACTGATGAACCAGGG + Intergenic
1166023903 19:40061469-40061491 AATCAAACACTGAGGAAATTTGG + Intergenic
1168612291 19:57811068-57811090 CAGTAAATACTGAAGGAACTCGG + Intronic
925620985 2:5792602-5792624 AGGTAAACAATGATGAAAATAGG - Intergenic
925753688 2:7112108-7112130 AAGCAAACACTGAGGAAGCCTGG + Intergenic
925796761 2:7554158-7554180 AAGAAAAAGCTGATGAGACTGGG - Intergenic
926211319 2:10872669-10872691 AAGTAAACCATGATTAAAGTAGG - Intergenic
926221160 2:10936411-10936433 AAGTAAACAATGACAAAGCTTGG + Intergenic
926262269 2:11276025-11276047 AAGAAAACACTGAACAAACCAGG + Intronic
927115416 2:19896149-19896171 AAGTAATCATTGATAAAAATAGG - Intergenic
927967915 2:27283153-27283175 AAGTAGACCCTGTGGAAACTGGG + Intronic
928384614 2:30855787-30855809 AAATAAACAGTGGTGAAAATGGG - Intergenic
928486801 2:31740362-31740384 AATTAAACAATGAGGACACTTGG - Intergenic
928817128 2:35311040-35311062 AACTAAACACTGTTGAAATCAGG + Intergenic
930341280 2:50118433-50118455 AAGAAAACACTTATGAAACCAGG - Intronic
930413327 2:51055236-51055258 AATAAAACACTGATGATATTTGG - Intergenic
930630058 2:53743726-53743748 ATGTAAGCAATTATGAAACTAGG - Intronic
931161639 2:59698716-59698738 CAAAAAAGACTGATGAAACTGGG - Intergenic
933118706 2:78507358-78507380 ATGTTAACAATGAGGAAACTGGG - Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933644798 2:84802000-84802022 AAGTAATCACTGAGGGAATTTGG + Intronic
933656250 2:84889260-84889282 ACTGAAACGCTGATGAAACTGGG - Intronic
934184142 2:89656535-89656557 AACAAAACATTGATGATACTGGG - Intergenic
934294431 2:91730672-91730694 AACAAAACATTGATGATACTGGG - Intergenic
934480549 2:94637736-94637758 ATGTAACCACTGGGGAAACTAGG + Intergenic
935722077 2:105988590-105988612 AAGTAATTTCTGTTGAAACTTGG - Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
938269145 2:129953917-129953939 GAGAAAACAATCATGAAACTGGG - Intergenic
939798326 2:146676606-146676628 AAAACAACACTGATGAAAATTGG + Intergenic
940028184 2:149230965-149230987 AAATAAACACGAATGAAACATGG - Intergenic
940272520 2:151907091-151907113 CAGTAAACATTTATAAAACTAGG - Intronic
941112786 2:161434781-161434803 AAGTAAACACTGAGTACACATGG - Intronic
941135105 2:161706197-161706219 AAGAAAACACTGAAGGAAATTGG + Intronic
942251408 2:174050280-174050302 ATGTTAACAATGAGGAAACTGGG - Intergenic
943579453 2:189667857-189667879 AAGGAAATAATGATGGAACTGGG + Exonic
944242827 2:197501809-197501831 AGGCAAACACTGATCACACTAGG - Intronic
944773700 2:202939996-202940018 AATGAAAAACTGCTGAAACTAGG - Intronic
945263276 2:207864561-207864583 GAGTAAAGGTTGATGAAACTGGG + Intronic
946755184 2:222937445-222937467 AAGCAAACACTGACATAACTAGG - Intronic
947053473 2:226074177-226074199 GAGTAAATATTGAAGAAACTGGG + Intergenic
947410058 2:229828172-229828194 AAGTAGGCACTGTTGAAGCTGGG + Intronic
948420842 2:237859363-237859385 AAATAAACACTTTTTAAACTAGG - Intronic
1168947205 20:1771007-1771029 ATGTAAACACTGAAGCTACTTGG + Intergenic
1170346570 20:15393460-15393482 AAGGAAAAATTTATGAAACTGGG - Intronic
1170703564 20:18725834-18725856 AAGAAAACACTGATGATATCGGG - Intronic
1170733478 20:18993654-18993676 AAGTAAACACATAGGAAAGTGGG - Intergenic
1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG + Intergenic
1174330650 20:49814663-49814685 AAGTAAACAGTGTTGGACCTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174975688 20:55330700-55330722 AAATACACACTGAAGAATCTAGG - Intergenic
1176739573 21:10588182-10588204 AAAAAAACACTCAAGAAACTAGG - Intronic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1179361927 21:40717892-40717914 AAGTAAACACTGAGTAGACAGGG + Intronic
1179537890 21:42063927-42063949 AAATAAACTCTGCTGAAACTGGG - Intronic
1180333157 22:11551026-11551048 AAGAAAACATTGGGGAAACTAGG + Intergenic
1180464606 22:15599704-15599726 GAGAAAACAATCATGAAACTGGG + Intergenic
1180817512 22:18800872-18800894 AACAAAACATTGATGATACTGGG + Intergenic
1181203701 22:21235192-21235214 AACAAAACATTGATGATACTGGG + Intergenic
1181893542 22:26085949-26085971 AATTAAACACTGATGAGAATTGG - Intergenic
1203223219 22_KI270731v1_random:60222-60244 AACAAAACATTGATGATACTGGG - Intergenic
1203267610 22_KI270734v1_random:26598-26620 AACAAAACATTGATGATACTGGG + Intergenic
949111974 3:271773-271795 AAGTGAACATTGATGAATGTGGG + Intronic
949588826 3:5471402-5471424 AACTAAACAGTGATAAATCTGGG + Intergenic
949895616 3:8765883-8765905 AAGCAAACACTGAGCTAACTGGG + Intronic
951165063 3:19475529-19475551 AAATAAACAGTGAGGAAATTAGG - Intronic
951277987 3:20712732-20712754 AATTAAACATGGATGAGACTGGG + Intergenic
951559223 3:23948953-23948975 AAGAGAGGACTGATGAAACTGGG - Intronic
952124596 3:30285764-30285786 AAGTAAATAAATATGAAACTAGG - Intergenic
953028571 3:39160537-39160559 AAGTAAACATTTATGAAATGTGG - Intergenic
953306767 3:41838742-41838764 AAGCAAAAACTGATCGAACTTGG + Intronic
954029877 3:47811496-47811518 CAGTAAACACTGGTGGAAGTTGG + Intronic
955458703 3:59155197-59155219 AAGTAGACACTGATAGATCTAGG - Intergenic
958083621 3:88778938-88778960 GAATAAACAGTGATGAAAGTGGG - Intergenic
958829532 3:99070760-99070782 AGGTCATCACTGATGAAAATCGG - Intergenic
959656902 3:108817304-108817326 AATTAAACTCTGAGAAAACTAGG - Intergenic
959721262 3:109492118-109492140 AAGTCAACCCTGAGGATACTAGG - Intergenic
960214865 3:115019858-115019880 AAGGAAAAACTGAGCAAACTAGG + Intronic
960545806 3:118913770-118913792 ACGTAAACGATGATGAAAATGGG + Intronic
960680351 3:120241319-120241341 AATAAAACACTTTTGAAACTGGG + Intronic
962442238 3:135431357-135431379 GAGCAAACACTGAGGAAACTGGG + Intergenic
962587535 3:136857709-136857731 AAGTTAACACTGATGTTTCTAGG - Intergenic
963843889 3:150135133-150135155 AAGCAAACACAGATAAAACTGGG + Intergenic
965026759 3:163311767-163311789 AAGTAAATAATGGTGAAATTAGG - Intergenic
965100389 3:164290820-164290842 AAGAAAACACAGAGAAAACTAGG + Intergenic
965270188 3:166606020-166606042 AAGTTAACACTTATGAAGTTGGG - Intergenic
965656147 3:170987434-170987456 AGGTAAACACTGATGAGGCATGG - Intergenic
966185653 3:177224374-177224396 AAGTAAATAATGATGAAATTTGG - Intergenic
967804237 3:193700688-193700710 AAGTAAACATTTATGATATTAGG + Intergenic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
971098986 4:23441326-23441348 AAGTAAAGAAAGATGAAACCTGG - Intergenic
971460933 4:26895611-26895633 GACTTAAAACTGATGAAACTGGG - Intronic
972098858 4:35385973-35385995 AAATAAATGCTGATTAAACTGGG - Intergenic
972467814 4:39374144-39374166 AAATAAACACAGATTAAAGTAGG - Intergenic
974490641 4:62559044-62559066 ATGCAAACACCCATGAAACTTGG - Intergenic
975090278 4:70393781-70393803 AAGTAAACGCTAAATAAACTTGG + Intergenic
976035538 4:80815492-80815514 CAGTAAACAGTGTTGAAAGTAGG + Intronic
976141364 4:81996133-81996155 AAGTAAACACTGACAACACAGGG - Intronic
977135808 4:93302863-93302885 TAGCAAAAGCTGATGAAACTTGG + Intronic
977545414 4:98371036-98371058 AAACAAAAACTGATAAAACTAGG - Intronic
979774609 4:124573571-124573593 AAGTAAAGATTAAAGAAACTGGG + Intergenic
980221462 4:129922090-129922112 CATTAAACACTGATAAAACCAGG - Intergenic
980766028 4:137305470-137305492 AAGTAAATGCTGTTGAAACCAGG - Intergenic
980971921 4:139574894-139574916 AAGATAACACTTTTGAAACTAGG - Intronic
983420687 4:167511682-167511704 AAGTAAACAATGATTAAAATTGG - Intergenic
985135975 4:186786498-186786520 AAGTAAACACTGAGGTGAGTTGG + Intergenic
985312004 4:188612220-188612242 AAGTGAACAACAATGAAACTAGG + Intergenic
987043399 5:14084525-14084547 AAGTAAACACACATAAAAATGGG + Intergenic
987380448 5:17280501-17280523 AAATGAAGACTGAGGAAACTTGG - Intergenic
990407377 5:55504543-55504565 AAAAAAAGACTAATGAAACTAGG + Intronic
990982754 5:61616482-61616504 AAGTCAACACTGATGATCCTTGG + Intergenic
991323424 5:65402456-65402478 AAGTAATCATTGATGAAAGTAGG - Intronic
991485223 5:67128634-67128656 ATGTTAACATTGATTAAACTGGG + Intronic
992833309 5:80616443-80616465 ATGTAAACAATCATGAATCTAGG + Intergenic
993087755 5:83384240-83384262 AAATAAACACTCAACAAACTAGG + Intergenic
995005252 5:107185040-107185062 AAGTGAACACTGAAGCAGCTGGG - Intergenic
995102745 5:108334350-108334372 AAGTAACCAGTGATCAAACAAGG - Intronic
995206269 5:109485050-109485072 AAGTAAAGGCTGAGGAACCTGGG + Intergenic
995522535 5:113024560-113024582 GGGTAACCACTGAGGAAACTAGG + Intronic
996315221 5:122153644-122153666 ATGTAGACACTGAAGCAACTAGG + Intronic
996434478 5:123419703-123419725 CAGTAAACATTGATGAAATGGGG - Intronic
996514227 5:124351975-124351997 GAGTAAATACTGATGAATTTTGG - Intergenic
998449754 5:142225222-142225244 AAGTAAAAACAAATGTAACTGGG - Intergenic
998580332 5:143367229-143367251 AAGAAAACACTCAACAAACTAGG + Intronic
998801853 5:145877013-145877035 AAGTAAAATATGATTAAACTGGG - Intergenic
999663124 5:153886255-153886277 TAGTAAAACTTGATGAAACTGGG - Intergenic
1001943239 5:175755540-175755562 AAGTTATAACTGATGCAACTAGG + Intergenic
1003355074 6:5360950-5360972 AACTAAGCACAGTTGAAACTTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005227928 6:23664732-23664754 TATTCATCACTGATGAAACTGGG - Intergenic
1005248409 6:23915420-23915442 ATGCAAACACTGATCAGACTGGG - Intergenic
1005622830 6:27635703-27635725 AAGAAGACCCTGATGAAGCTGGG - Intergenic
1006311051 6:33260391-33260413 ATATAAACACTGATGAGACAAGG - Intronic
1010550210 6:77212460-77212482 AACTAAACACTTATCAAACATGG + Intergenic
1010692416 6:78925975-78925997 AAATAAGCACTGATTAAACATGG + Intronic
1010942815 6:81939041-81939063 TAGTAAACACTGATTACACTTGG + Intergenic
1012542388 6:100376352-100376374 AAGTAAACACAGAGGCACCTTGG + Intergenic
1012988465 6:105899809-105899831 AAGTAAACAGTGGTGAGGCTAGG - Intergenic
1016261916 6:142182111-142182133 AAGTAGACAGTGATAAAAATGGG - Intronic
1020586165 7:10071093-10071115 AAATAAACACTTAGGAAGCTAGG + Intergenic
1021449977 7:20776124-20776146 AAGCACACACTGATGAAAGCTGG - Intronic
1021864285 7:24939551-24939573 AAGAAAAGACTAAAGAAACTGGG + Intronic
1021995509 7:26175801-26175823 AAGCAAACACTGATCAAATATGG - Intronic
1024321119 7:48070721-48070743 CAGTAAACACTGTTGAATATAGG - Intergenic
1026186792 7:68088244-68088266 AGGAAAAAAATGATGAAACTTGG - Intergenic
1026810058 7:73456075-73456097 AAATAAAAAGTGAGGAAACTGGG + Intronic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027502433 7:78969831-78969853 GAGTAAACACTGATTAATATTGG - Intronic
1027633746 7:80643114-80643136 CAGTAACCACTGAAGAAACCAGG - Intronic
1027840304 7:83302030-83302052 ATGTGAACACTGAAGAAAATTGG + Intergenic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG + Intergenic
1030565056 7:111143348-111143370 AGGTAAACACTCATGACACAAGG + Intronic
1030830135 7:114210435-114210457 AAGGAAAAACTGAGGCAACTGGG - Intronic
1033668930 7:143471305-143471327 AACTATCCACTGATGAAAATAGG + Intergenic
1033680449 7:143589312-143589334 ATGTAACCACTGGTGAATCTAGG - Intergenic
1033704445 7:143872500-143872522 ATGTAACCACTGGTGAATCTAGG + Intronic
1033732013 7:144189306-144189328 AAATAGAAACTGATGGAACTGGG + Intronic
1033742862 7:144287889-144287911 AAATAGAAACTGATGGAACTGGG + Intergenic
1033751040 7:144361725-144361747 AAATAGAAACTGATGGAACTGGG - Intronic
1034403988 7:150889364-150889386 ATGAAAACACTGAACAAACTAGG + Intergenic
1037036317 8:14172544-14172566 ATGTAAACAGTTATAAAACTGGG + Intronic
1037193574 8:16157847-16157869 AAGCCAACACTGAGGGAACTAGG - Intronic
1037250584 8:16888788-16888810 ATGTAACCACTGTAGAAACTTGG - Intergenic
1038035683 8:23684097-23684119 AAATAAACACTGAAGTAAGTAGG + Intergenic
1042788722 8:72579785-72579807 AAGAACACTCTGATGATACTAGG - Intronic
1043155485 8:76773408-76773430 AACTTAACACTGAACAAACTTGG - Intronic
1044161882 8:88929114-88929136 AACAAAACAGTGATGACACTTGG + Intergenic
1045615412 8:103903910-103903932 ATATAACCACTGAGGAAACTCGG - Intronic
1045715229 8:105035985-105036007 ACGTACACACTTATCAAACTTGG - Intronic
1045809073 8:106200623-106200645 AAGCAAACACTGGGGCAACTGGG - Intergenic
1046560785 8:115834730-115834752 AAGTACACACAGAATAAACTAGG + Intergenic
1047196370 8:122725698-122725720 AAGTAAAGGCTGATGAAAGGTGG + Intergenic
1047458573 8:125039713-125039735 GAGTAAGAACTGAAGAAACTGGG + Intronic
1048920653 8:139227041-139227063 AAGTAAAAACTGATCAGACAAGG + Intergenic
1051066777 9:13114417-13114439 AAGGACAGACTGATGAAAATGGG + Intronic
1053677285 9:40446204-40446226 ATGTAACCACTGGGGAAACTAGG - Intergenic
1053927042 9:43072360-43072382 ATGTAACCACTGGGGAAACTAGG - Intergenic
1054290358 9:63281731-63281753 ATGTAACCACTGGGGAAACTAGG - Intergenic
1054388380 9:64586267-64586289 ATGTAACCACTGGGGAAACTAGG - Intergenic
1054507337 9:65930091-65930113 ATGTAACCACTGGGGAAACTAGG + Intergenic
1054892147 9:70262329-70262351 AAGTAGAAAAAGATGAAACTCGG + Intronic
1056013733 9:82359839-82359861 AAGCAAAGACTAAAGAAACTGGG - Intergenic
1056277251 9:85005424-85005446 TAGTAAACGGTAATGAAACTAGG + Intronic
1056665922 9:88580636-88580658 GTGTAAACACTGGGGAAACTGGG - Intronic
1057234452 9:93347438-93347460 ACTTAAACACTGATGAATTTGGG - Intergenic
1057896243 9:98911256-98911278 AAGTAATCCCTGCGGAAACTGGG - Intergenic
1058428089 9:104893456-104893478 AAGAAAATACTAATGAAATTAGG + Intronic
1058663839 9:107290731-107290753 AAATAAAAACTGATGAAAGCAGG - Intronic
1060695286 9:125704379-125704401 AAGGAAACACTGATGATGGTAGG - Intronic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1060867528 9:127011956-127011978 AAGTAAACACTAATGAATTTCGG - Intronic
1185829103 X:3281834-3281856 AATTTAAAACTGATGAAAATTGG + Intronic
1185992674 X:4909751-4909773 ACATAAACATTGCTGAAACTTGG + Intergenic
1187344822 X:18453532-18453554 AAGAAAACATTCATGAAACCAGG - Intronic
1187646228 X:21349468-21349490 CAGGAAAAACTGAGGAAACTAGG + Intergenic
1188262814 X:28038863-28038885 AAGGAAACTCTGATGACTCTGGG + Intergenic
1191227954 X:58065482-58065504 CAATAAACACTGAGGGAACTCGG - Intergenic
1191815149 X:65235826-65235848 AAGTAAAAACTGAGGTAACACGG - Intergenic
1193222807 X:78946646-78946668 AATTAACCACTTATGAAAGTAGG + Intronic
1194349608 X:92809481-92809503 AAGTAAACATTGATAAATTTAGG - Intergenic
1195160575 X:102166884-102166906 AAGTAAACCCTGAAAAAATTGGG + Intergenic
1195393980 X:104391448-104391470 AAGTATTCAGTGATGAACCTGGG + Intergenic
1195670326 X:107464380-107464402 AAGGAATCACTGAGCAAACTGGG - Intergenic
1195833101 X:109082395-109082417 AGGTAAACACTGATTACACATGG - Intergenic
1196280889 X:113822472-113822494 ATGAAAAAACTGATGAATCTAGG - Intergenic
1196297150 X:114011214-114011236 AAAAAAACACTCATAAAACTAGG - Intergenic
1197306099 X:124843840-124843862 AAGAAAACACTAAAGAAAGTAGG - Intronic
1197538810 X:127728272-127728294 GAGTACACACAGAGGAAACTGGG - Intergenic
1198049644 X:132938271-132938293 AAAGAAACACTCATCAAACTAGG + Intronic
1198378510 X:136062486-136062508 CAGTAGACACTCATGAATCTTGG - Intergenic
1199837535 X:151606924-151606946 AAGTAAAAACTTTTAAAACTGGG - Intronic
1200657927 Y:5926082-5926104 AAGTAAACATTGATAAATTTAGG - Intergenic
1201265707 Y:12204558-12204580 ATGGAACCACTGATGAAATTTGG + Intergenic
1202597870 Y:26562017-26562039 AAAAAAACACTCAAGAAACTAGG - Intergenic