ID: 1080787215

View in Genome Browser
Species Human (GRCh38)
Location 11:35486567-35486589
Sequence CTGCTGTCCTTGAGAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080787212_1080787215 14 Left 1080787212 11:35486530-35486552 CCTGCCTAGGTGATAGACTGGTT 0: 1
1: 0
2: 2
3: 32
4: 638
Right 1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 206
1080787213_1080787215 10 Left 1080787213 11:35486534-35486556 CCTAGGTGATAGACTGGTTGCTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080787215 Original CRISPR CTGCTGTCCTTGAGAAAGCC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900681525 1:3919464-3919486 CCACTGTCCTTGAGAAAGGGAGG - Intergenic
900805559 1:4765363-4765385 CTGCTGCCCCTGAGCAATCCTGG - Intronic
900933536 1:5751368-5751390 CAGCAGTCCATGAGAAAGCGCGG + Intergenic
901282249 1:8047337-8047359 CTGCTGGAGATGAGAAAGCCTGG - Intergenic
902735286 1:18396710-18396732 CTGCTTTCCTTCTGAAAGTCTGG + Intergenic
905187066 1:36204301-36204323 GTGCTGAGGTTGAGAAAGCCTGG - Intergenic
905662089 1:39735478-39735500 CTGCTGTCCATGTGCAGGCCAGG + Intronic
910346763 1:86247873-86247895 CTGCTTTTCTTGTGGAAGCCTGG - Intergenic
910503234 1:87918705-87918727 CTGCTGTGCTTGAGACAGCATGG - Intergenic
911604682 1:99890324-99890346 CTGCTGTCCATGAAAATGCCAGG + Intronic
911883043 1:103265863-103265885 CTGCAGTCATTGAGGAAGTCAGG - Intergenic
913334626 1:117697860-117697882 CTCCTTTTCTTGAGAAACCCAGG - Intergenic
914376998 1:147080469-147080491 CAGCTGTCCTTGGGACAGCAAGG + Intergenic
914665835 1:149832006-149832028 CTGACGTCCATGAGAAAGCTTGG + Intergenic
914669930 1:149861788-149861810 CTGACGTCCATGAGAAAGCTTGG - Intronic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
916619744 1:166483838-166483860 ATGCTGTCCATGAAAAAGCTGGG - Intergenic
918352364 1:183670331-183670353 ATTCTGTTCTTAAGAAAGCCTGG - Intronic
919546681 1:198930458-198930480 CAGCAATCCTTGAGAAACCCAGG - Intergenic
919963922 1:202501988-202502010 CTGCTGTCCTTGACATAGGTGGG + Intronic
920384180 1:205556421-205556443 CAGCTGTTCTTGAGTAAGCATGG - Intergenic
1065406996 10:25379460-25379482 AGGCTGTCATTGAGAAAGCCAGG + Intronic
1070142651 10:73749845-73749867 CTGCTCTTCTTGAGAAAGTAAGG - Intronic
1070652797 10:78250062-78250084 GTGCTGTGGTTGAGAAACCCTGG + Intergenic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1072048681 10:91682117-91682139 CTGCTGCCCTAGCTAAAGCCTGG - Intergenic
1075058540 10:119238208-119238230 CTGCTGTGCTGGTGACAGCCGGG + Intronic
1076629699 10:131844878-131844900 CTGCTGTCCTGGAGAAGCCTTGG + Intergenic
1076648641 10:131971845-131971867 GGGATGTCCCTGAGAAAGCCTGG + Intronic
1076729181 10:132429751-132429773 CTGCTCTCCTGGAGACAGCATGG - Intergenic
1079469116 11:20761477-20761499 CTGCTTTTCTTGAGAATACCAGG + Intronic
1080233457 11:30043659-30043681 CTGCTGTGCTTTAGAAAGCTGGG - Intergenic
1080656379 11:34261919-34261941 CTGCTGTCCTCCAGAAATGCTGG - Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1084873502 11:72113575-72113597 CTGCTGTCCCTGAAAGAGGCTGG - Intergenic
1085235400 11:75010597-75010619 CTGTGATCCTTGGGAAAGCCAGG - Exonic
1085631768 11:78124011-78124033 ATGCTGTCCGTGAGTAAGTCTGG - Exonic
1087213025 11:95462294-95462316 CTGCTTCCCTTTAGAAAGCTAGG + Intergenic
1089557051 11:119320601-119320623 CTGCGGTCCCTGGGAAAGCCAGG - Intronic
1089588661 11:119525973-119525995 CTGGGCTCCTTGAGCAAGCCAGG + Intergenic
1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG + Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1091194296 11:133718356-133718378 CTGCTGGGCTTGAGAAAGCCTGG - Intergenic
1091194556 11:133720036-133720058 GTGCTGGGCTTGAGAAAGCCTGG - Intergenic
1091353107 11:134913441-134913463 CTGCTCTCCCTGAGCGAGCCTGG - Intergenic
1091727635 12:2856860-2856882 CTGCTGCCCAGAAGAAAGCCTGG + Intronic
1092517913 12:9235143-9235165 CTTTTGTCCCTGTGAAAGCCAGG + Intergenic
1095985440 12:47996127-47996149 CTGCTGTCCAGGAGAAAGCAAGG - Intronic
1097533060 12:60829974-60829996 ATGCTCTCCTGAAGAAAGCCTGG - Intergenic
1097612562 12:61842398-61842420 CTGTTGTCCTTGAAAATGTCAGG + Intronic
1098571014 12:71987336-71987358 CTGCAGTGCTTAAAAAAGCCTGG - Intronic
1100934583 12:99648449-99648471 CTGCTGTCTGTGACAATGCCAGG + Exonic
1102358092 12:112257370-112257392 CTGCTGCTCTAGAGAAACCCAGG + Intronic
1104588475 12:130066000-130066022 ATGCTGTCCTTGTGACAGACAGG + Intergenic
1104656741 12:130579287-130579309 CTGCTTTCCTTATGAGAGCCTGG + Intronic
1105831042 13:24162998-24163020 CGGCTGTCCCTCAGAAAGCCTGG + Intronic
1106554705 13:30799491-30799513 CTGCTGCTCCTTAGAAAGCCAGG + Intergenic
1106802136 13:33267143-33267165 GTGCTGTCCTTGAAAAACCAGGG - Intronic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1109030281 13:57181280-57181302 CTAGTGCCCTTGAGAAACCCTGG + Intergenic
1109097243 13:58134070-58134092 CTGCTGTCTCTGAGGAATCCGGG - Intergenic
1110397113 13:75043585-75043607 CTGCTGTCTTTAAGAGACCCAGG + Intergenic
1111788095 13:92816731-92816753 GTTCTGTCCCTCAGAAAGCCTGG - Intronic
1112452720 13:99526618-99526640 CTGCTGTCATTGATAAAGGCAGG + Intronic
1113625976 13:111846768-111846790 CTGCTGTCCTGGAGTATTCCTGG + Intergenic
1119222219 14:72918208-72918230 AGGCTGTCCTGGAGAAACCCAGG + Intergenic
1121267525 14:92614018-92614040 CTGCCCTGCTTGGGAAAGCCAGG - Intronic
1122077390 14:99245375-99245397 CTTTTGTCCTTGAGAAAAGCGGG + Intronic
1123922283 15:25078818-25078840 CAGGTGTGCTTGAGAAAGGCAGG - Intergenic
1123922827 15:25082545-25082567 CGGGTGTGCTTGAGAAAGGCAGG - Intergenic
1125751514 15:42032464-42032486 GTGCTGTCCTTGTCAAACCCAGG - Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1127523438 15:59767820-59767842 CTGCTATACTTGAGAATGCCAGG - Intergenic
1128328866 15:66742766-66742788 GAGCTGTCCTTAAGGAAGCCAGG + Intronic
1131346384 15:91652899-91652921 CTGCTGTGCTTCAGAAAGAGAGG + Intergenic
1132474435 16:126617-126639 CTGGTGTCCCTCAGAAAGGCTGG - Intronic
1132810743 16:1795435-1795457 GTCCTGTCCTACAGAAAGCCAGG - Intergenic
1134268459 16:12712021-12712043 CTACTGTCCCTGAGAAATGCAGG + Intronic
1134864579 16:17593302-17593324 GGGCTGACATTGAGAAAGCCTGG + Intergenic
1135522112 16:23185815-23185837 ATGCTGCCCTTGAGGAAGGCGGG + Intronic
1137706824 16:50541209-50541231 CAGCTTTCCTGGAGAAAGACAGG - Intergenic
1141385414 16:83618547-83618569 CTGCTGCCGATGAGAAACCCAGG + Intronic
1141571787 16:84938575-84938597 CTGCTGTCTTAAAGAAAACCTGG + Intergenic
1143411417 17:6711933-6711955 CTGCTGTCCTTGACCCATCCAGG + Intronic
1144778059 17:17794836-17794858 CTGCTGTCCTTGACCAGGCTGGG - Exonic
1145942229 17:28748592-28748614 CAGCTGTCCTTCAGATGGCCTGG - Exonic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147382599 17:40064098-40064120 CTCCTGTCCTTGAGTCTGCCTGG - Intronic
1147632528 17:41941318-41941340 CTGGGGGCCTGGAGAAAGCCAGG - Intronic
1148272531 17:46274070-46274092 CTGCTGTCCAGGAGAATTCCAGG + Intergenic
1148338520 17:46858543-46858565 CTGCTGCTTTTGAGTAAGCCTGG + Intronic
1148480097 17:47954391-47954413 CTCCTGTCCTTGTGGAAGCTTGG - Intronic
1148583103 17:48757167-48757189 CTCCTATGCTTGAGAAAGCAGGG + Intergenic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1151282005 17:73083229-73083251 CTGCTGTGCCTGAGAATGCCGGG - Intronic
1151799373 17:76368710-76368732 GTGCTGAGCTTGAGAAAGCCTGG + Intronic
1152287365 17:79420896-79420918 CAGCTGACCTCTAGAAAGCCTGG + Intronic
1153673930 18:7438975-7438997 CTGCTGTCCTGGAGATAGGGAGG + Intergenic
1153967162 18:10192389-10192411 TGGCAGTCCTTGAGCAAGCCTGG - Intergenic
1154002369 18:10493352-10493374 TTGCTCTTTTTGAGAAAGCCAGG - Intergenic
1159628724 18:70724774-70724796 CTTCTGTCCTTGAGTTGGCCAGG + Intergenic
1159736786 18:72109666-72109688 CTGCTGTTCTTGTGATAGCTAGG + Intergenic
1162997645 19:14346420-14346442 GTGCTGACATTGAGAAACCCTGG + Intergenic
1163027587 19:14521584-14521606 CTCCCCTCCTTGAGTAAGCCTGG + Intronic
1163054965 19:14711176-14711198 CTGCTTTCCTTCTGAAAGTCTGG - Intronic
1166416162 19:42596092-42596114 CTGCTGTCCTTCGTGAAGCCAGG - Intronic
1168132168 19:54328538-54328560 CAGCTGTCCTAGAGAGAGGCAGG + Intergenic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
925979823 2:9167568-9167590 CTGCATTCCTTGTGAAAGCAAGG + Intergenic
927493018 2:23532935-23532957 CAGCTGGCGGTGAGAAAGCCTGG + Intronic
927637045 2:24824275-24824297 CCCCTGTCCCTGAGAAGGCCTGG + Intronic
928197970 2:29228669-29228691 ATGCTGTCGCTGAGGAAGCCTGG + Intronic
928404091 2:31001112-31001134 CTGTGGTCCTGGAGATAGCCTGG - Intronic
928648595 2:33381772-33381794 CAGCTGTCCTTTTGAAACCCTGG - Intronic
932654030 2:73592607-73592629 CTGCTGGCCTTCAGCTAGCCAGG - Intronic
934165211 2:89288178-89288200 CACCTGCCCTTCAGAAAGCCAGG - Intergenic
934202062 2:89894284-89894306 CACCTGCCCTTCAGAAAGCCAGG + Intergenic
940926245 2:159366626-159366648 ACGCTGCCATTGAGAAAGCCTGG + Intronic
941484647 2:166065164-166065186 GTTCTGTCCTTGAAATAGCCTGG + Intronic
942202964 2:173590557-173590579 CTCCTGGGCTTGTGAAAGCCAGG - Intergenic
943446436 2:187993592-187993614 CTGCTGTCTTTGGGACAGCAGGG - Intergenic
945022566 2:205588885-205588907 CTCCTGTGCTTTTGAAAGCCAGG - Intronic
946302591 2:218832865-218832887 CAGATGTCCTTGAGAAAGGCTGG - Intergenic
1169811926 20:9617253-9617275 GTACTTTTCTTGAGAAAGCCAGG + Intronic
1172511366 20:35503434-35503456 AAGCTGTCCTTGAGAGAGCGAGG + Exonic
1176240887 20:64075336-64075358 CTGCTTCCCTTGAGACAACCGGG - Intronic
1179807785 21:43851036-43851058 CTGCTGTCCTTGTGATAGTGAGG - Intergenic
1180150544 21:45944925-45944947 CCACTGTCCTTGAGGAAGCAAGG - Intergenic
1180161760 21:46001403-46001425 CACCTGGGCTTGAGAAAGCCGGG - Intronic
1182297540 22:29318581-29318603 CTGCTGGTCTTTAGGAAGCCTGG - Intronic
1182432547 22:30308751-30308773 ATGATGTCATGGAGAAAGCCAGG - Intronic
1183110352 22:35644205-35644227 CTGCTCTCCTTGTGGTAGCCTGG - Intergenic
1183816526 22:40306514-40306536 CTTCTGCCTTTGAGAAAACCAGG - Intronic
950173057 3:10852578-10852600 CTGGTGGCCTGGAGAAGGCCAGG + Intronic
950854428 3:16091921-16091943 CTGCACTCTTTGAGAAAGCAGGG - Intergenic
951495431 3:23320059-23320081 CTCCTGCCCATGGGAAAGCCAGG + Intronic
951715367 3:25637809-25637831 CTGTTTTCCTTGAGAAGGTCAGG - Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954601687 3:51875361-51875383 TTGAAGTCCTAGAGAAAGCCAGG - Intronic
954846774 3:53566294-53566316 TTGCTGTTCTTCAGAATGCCAGG + Intronic
955006795 3:54976170-54976192 CTGCTGTCTTTTAGAAAGTAAGG + Intronic
962369631 3:134810631-134810653 CAGCTGAGCTTGACAAAGCCGGG + Intronic
964218321 3:154314377-154314399 CTGCTGTCTTTGATAAAGGAAGG - Intronic
967518725 3:190402677-190402699 CTGCTGTCCCTCAGAGGGCCAGG + Intronic
967827189 3:193886511-193886533 CTGCTTTCCTTTTCAAAGCCAGG - Intergenic
969843142 4:9898538-9898560 CTGTAGTCCCTGAGAAAGTCAGG - Intronic
969859200 4:10022437-10022459 GTACTGTCCTTGAGCCAGCCTGG - Intronic
970090084 4:12396655-12396677 GTGCTGCCATTGAGAAATCCTGG - Intergenic
970769068 4:19588324-19588346 CTGATTTGCTTGAGAAAGCAAGG + Intergenic
970850864 4:20601204-20601226 CTGCTGTTCTAGAGATAGTCTGG + Intronic
974193647 4:58540619-58540641 CTATTATCCTTGGGAAAGCCTGG + Intergenic
975820877 4:78269125-78269147 CTGTTGACCTTGTTAAAGCCTGG + Intronic
975890270 4:79019203-79019225 CAGCTGTCCTTGAGAAGTCAGGG + Intergenic
976253896 4:83080923-83080945 CTGCTGTCCATCTGAAAGTCTGG - Intergenic
978021536 4:103819536-103819558 CTGCTTTCCTTGGGAATGGCAGG + Intergenic
979612112 4:122700343-122700365 GTGCTGTCCGTGGGAAGGCCTGG - Intergenic
980176540 4:129352789-129352811 CTTTTGTTCTTTAGAAAGCCTGG + Intergenic
980697056 4:136372040-136372062 TTGCTGTACTTGACATAGCCTGG - Intergenic
981277687 4:142921049-142921071 CTGATGACCTTGAGAAACACAGG + Intergenic
983432529 4:167670007-167670029 ATGCTGTCCGTGTGAAAGTCTGG + Intergenic
983671993 4:170248107-170248129 CTACTATCCCTGAGAAAGCAAGG - Intergenic
986231158 5:5865919-5865941 CTGCTGTCCTTATGAGAGACAGG - Intergenic
986261572 5:6152096-6152118 CCGCTGTCCTTGAGATGTCCTGG + Intergenic
988220461 5:28339568-28339590 CTGCTGTCCTTCACAATGACTGG + Intergenic
989111169 5:37907763-37907785 CTGCTGCCCTTGAGAAAATGTGG - Intergenic
993189272 5:84660532-84660554 CTGGAGCCCTAGAGAAAGCCAGG - Intergenic
994439132 5:99779946-99779968 CTGTTGTCCTTGAACAAGCAAGG - Intergenic
994597847 5:101861737-101861759 CTGGTGTCCCTGAAAAAGACAGG + Intergenic
996397699 5:123030029-123030051 TTGCTGTCCTTTGGAAAGCTGGG - Intronic
997585507 5:135040762-135040784 CTCCAGTCCCTGAGAAAGGCAGG - Intronic
998200035 5:140112347-140112369 GATCTGTGCTTGAGAAAGCCAGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004427731 6:15517528-15517550 GTGCAGCCCTTGGGAAAGCCGGG - Intronic
1004518328 6:16339526-16339548 CTGCTGTGCCTTAGAGAGCCTGG - Intronic
1004671180 6:17798672-17798694 CAGCAGTCCTTGTGAAAGCCAGG + Intronic
1004883582 6:20031802-20031824 CTTCTGACCTTCAGAAAGCGTGG + Intergenic
1006384765 6:33724314-33724336 CAGATGTCCTTTGGAAAGCCGGG - Intronic
1007688918 6:43685362-43685384 CTGCTGCTGTTGAGAAAGCCTGG - Intronic
1007896581 6:45367558-45367580 CTGAGGTCTTTGAGAAATCCAGG - Intronic
1008686400 6:53930310-53930332 CAGCAGTCCTTGGGAAACCCAGG + Intronic
1008709870 6:54211799-54211821 ATGCTGGCATTGAGAAACCCTGG + Intronic
1010534656 6:77012062-77012084 CTGCTGCCCTTCAGGGAGCCCGG + Intergenic
1011720598 6:90152146-90152168 CTGCTGTCCATGACAAAGAAAGG + Intronic
1013090856 6:106899734-106899756 CTGGTGTCCTGGAGAAGCCCTGG + Intergenic
1013305204 6:108841290-108841312 TTACTGTCCTGGAGAAAGTCGGG - Intergenic
1019430063 7:994939-994961 CTGCTGACCTGCAGCAAGCCAGG - Intergenic
1020769674 7:12373432-12373454 CTGCTCTCCTTGAGCAGGGCAGG + Intronic
1021528619 7:21617973-21617995 CTGCTGTCCTGGGGACAGCCTGG - Intronic
1023338397 7:39193770-39193792 CTGCCATCAGTGAGAAAGCCCGG + Intronic
1023558297 7:41446243-41446265 ATTTTGTCCTTGAGAAAGTCAGG - Intergenic
1023723552 7:43119342-43119364 CTGGTGTCCTGGAAGAAGCCAGG - Intronic
1023912037 7:44563127-44563149 CTGCCTTCCTTGAGAAAGTGAGG - Intergenic
1025839170 7:65127944-65127966 CTGTGGTCCTTCAGAAATCCTGG - Intergenic
1025883898 7:65568021-65568043 CTGTGGTCCTTCAGAAATCCTGG + Intergenic
1025889547 7:65634585-65634607 CTGTGGTCCTTCAGAAATCCTGG - Intergenic
1027133976 7:75611551-75611573 ATGATGTCCTTCAGAGAGCCTGG - Intronic
1028570511 7:92281287-92281309 CTGCTTTTCTTCAGAAAGTCTGG - Intronic
1031852909 7:126887392-126887414 CTGTGGTCCTTGAGAAATCCTGG + Intronic
1032137446 7:129293108-129293130 CTGATCAACTTGAGAAAGCCAGG - Intronic
1033607896 7:142940794-142940816 CTGCTGTCCTGAACAAAACCAGG - Exonic
1034081170 7:148278963-148278985 TTCCTGTCCTTGAACAAGCCAGG - Intronic
1034190462 7:149209456-149209478 CTGCAGTCCTTGATGAAGACAGG - Intronic
1035286191 7:157808784-157808806 CCGCTGTCCTGGACAAACCCTGG + Intronic
1036931064 8:12955874-12955896 CTGCTGTCATTGCCACAGCCTGG + Intronic
1036977236 8:13427330-13427352 CTGCTGTCCTGGAGACATCCAGG - Intronic
1037246929 8:16845783-16845805 CTGGTGTCCTTGAGAGAGTTGGG + Intergenic
1041400023 8:57432953-57432975 CTGCTGCCCTAGAGAAATGCAGG + Intergenic
1041830211 8:62144727-62144749 CGGCCGTCCCTGGGAAAGCCGGG - Intergenic
1042208428 8:66352421-66352443 CTGCTGTCCTTAACAAAGAGAGG - Intergenic
1042951140 8:74201933-74201955 CTGCTGTGATTTAGAAATCCAGG + Intergenic
1045022619 8:98057538-98057560 CTTTTGTCCTTAATAAAGCCGGG + Intergenic
1049317705 8:141978104-141978126 GTGCTGTTCTTGAGCAGGCCTGG - Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1055654393 9:78438771-78438793 CTGCTGAGGTTGAGGAAGCCTGG - Intergenic
1055727132 9:79242606-79242628 CTACTGTGCATGGGAAAGCCAGG + Intergenic
1056300003 9:85230888-85230910 CCTTTGTACTTGAGAAAGCCTGG - Intergenic
1061965142 9:134009435-134009457 CTGATATCCTTGAGCAAGTCAGG + Intergenic
1062300334 9:135863843-135863865 CTGCTGTCTGTGTGGAAGCCTGG - Intronic
1187088228 X:16064858-16064880 CTGCTGTAATGGAGAAAGGCAGG - Intergenic
1189290135 X:39878984-39879006 ATGCTGGCTTTGAGAAAGGCAGG - Intergenic
1192748625 X:73964798-73964820 CTGCTTTCCTTCCGCAAGCCTGG - Intergenic
1195681811 X:107552850-107552872 CTCTTGTCCTTGAGTATGCCGGG + Exonic
1198372809 X:136007409-136007431 ATGCTGTGGTTGAGAAACCCTGG + Intronic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1200135043 X:153870682-153870704 AAGCTGTTCTTGAGGAAGCCTGG + Intronic
1201607311 Y:15801139-15801161 CTGCTACCCTTGAGACAGCAAGG - Intergenic