ID: 1080787331

View in Genome Browser
Species Human (GRCh38)
Location 11:35487430-35487452
Sequence GTCATGTCTCAGCTTATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080787329_1080787331 -3 Left 1080787329 11:35487410-35487432 CCAGCTGGGATCCTTGGTCAGTC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1080787331 11:35487430-35487452 GTCATGTCTCAGCTTATTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 129
1080787323_1080787331 25 Left 1080787323 11:35487382-35487404 CCAGGCTCTTTCTGATTTCATGT 0: 1
1: 0
2: 1
3: 30
4: 393
Right 1080787331 11:35487430-35487452 GTCATGTCTCAGCTTATTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 129
1080787328_1080787331 -2 Left 1080787328 11:35487409-35487431 CCCAGCTGGGATCCTTGGTCAGT 0: 1
1: 0
2: 1
3: 24
4: 186
Right 1080787331 11:35487430-35487452 GTCATGTCTCAGCTTATTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 129
1080787327_1080787331 2 Left 1080787327 11:35487405-35487427 CCTTCCCAGCTGGGATCCTTGGT 0: 1
1: 0
2: 3
3: 17
4: 205
Right 1080787331 11:35487430-35487452 GTCATGTCTCAGCTTATTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080787331 Original CRISPR GTCATGTCTCAGCTTATTCT TGG Intronic
900251955 1:1675474-1675496 ATCATGTCTCGGATGATTCTGGG - Exonic
900262366 1:1738332-1738354 ATCATGTCTCGGATGATTCTGGG - Exonic
902627222 1:17683594-17683616 GGCATGTCTCAGCTACCTCTGGG - Intronic
904856062 1:33499085-33499107 GTCCTGCCTCATCTTGTTCTGGG + Intergenic
907794793 1:57705213-57705235 GTGATGTCTCAGATTATTTTAGG + Intronic
911716625 1:101140690-101140712 ATCATTTCTAAGCTTAATCTCGG + Intergenic
915842855 1:159230187-159230209 GTCATTTATCAGCTTCTTCATGG - Intergenic
917618747 1:176773008-176773030 GCCATGTCTCAGCTTTATGTTGG + Intronic
920615006 1:207483301-207483323 TTCATGTCTGAGCCTATTCTAGG - Intronic
923462855 1:234222256-234222278 GACATGGCTCAGCTCATTCCTGG - Intronic
924316477 1:242802747-242802769 GTCATTTCACAGCTGATTCCAGG + Intergenic
1063769180 10:9177885-9177907 GTCATATCTCAGCTCAGCCTTGG - Intergenic
1066103882 10:32140207-32140229 GTCCTGTCTCAGATGCTTCTGGG - Intergenic
1069103396 10:64352570-64352592 TTCATTTCTCAGATGATTCTGGG + Intergenic
1070884021 10:79874356-79874378 GTCACGTCACACCTTGTTCTTGG + Intergenic
1071122786 10:82298964-82298986 ATCAGGTGTCAGTTTATTCTGGG - Intronic
1071495753 10:86166773-86166795 GCCATGTCTAAGCTTTTGCTGGG + Intronic
1071650575 10:87390656-87390678 GTCACGTCACACCTTGTTCTTGG + Intergenic
1073340238 10:102738706-102738728 ATCATGTCTGAACCTATTCTTGG + Exonic
1076250362 10:128979840-128979862 GACTTGTCTCAGCTTATACAAGG - Intergenic
1080128210 11:28762678-28762700 GTAATTTCTCAGCTTTTTCAGGG + Intergenic
1080787331 11:35487430-35487452 GTCATGTCTCAGCTTATTCTTGG + Intronic
1081238274 11:40672676-40672698 GTAATCTCTCATCTTATTCTCGG + Intronic
1082118609 11:48355203-48355225 GTCATGTGTCAGATTACTCTGGG + Intergenic
1082255717 11:50030102-50030124 GTCATGCGTCAGATTACTCTGGG - Intergenic
1087730452 11:101772694-101772716 GACATGTTTCAGCTTATAATAGG - Intronic
1088036197 11:105318811-105318833 GGCATGTCTCAGCTTATCCTTGG + Intergenic
1090514235 11:127408248-127408270 GTCATTTCTCTGCTTGTTTTAGG + Intergenic
1091352755 11:134910596-134910618 GTCATGTCCCAGTTTATTCCAGG - Intergenic
1093349238 12:18077050-18077072 GTATTGTTTCAGCTTATTATGGG - Intergenic
1096068310 12:48758814-48758836 GTCATGTTTGAGCTAAGTCTTGG - Intergenic
1098285819 12:68905887-68905909 GTCATGTCTCAGATCCTCCTGGG + Intronic
1105691115 13:22840235-22840257 GTCACGTCTTGGTTTATTCTTGG - Intergenic
1111026461 13:82533652-82533674 AACATGTCTCAGCTCATTGTGGG - Intergenic
1113116133 13:106876610-106876632 GTCATGCCTAGGCTTACTCTAGG + Intergenic
1115997901 14:39212358-39212380 GCCATGTCTCTGTTCATTCTTGG + Intergenic
1117060279 14:51955253-51955275 GTCACCTCTCTGGTTATTCTGGG + Intronic
1122105000 14:99446368-99446390 ATTCTGTCTCAGATTATTCTAGG + Intronic
1124485731 15:30114158-30114180 GACATTTCTCAGCTGAGTCTGGG + Intergenic
1124517844 15:30383110-30383132 GACATTTCTCAGCTGAGTCTGGG - Intronic
1124540809 15:30583144-30583166 GACATTTCTCAGCTGAGTCTGGG + Intergenic
1124757847 15:32424436-32424458 GACATTTCTCAGCTGAGTCTGGG - Intergenic
1125305832 15:38312376-38312398 TTCCTGACTCAGCTTTTTCTTGG - Intronic
1127301932 15:57663339-57663361 CTCATGTCTCACCTTAGTTTGGG + Intronic
1128241219 15:66102302-66102324 GTCATGGCTCTGCTTGCTCTAGG - Intronic
1134800601 16:17081032-17081054 GACCTGTCTCAGATAATTCTGGG - Intergenic
1137724400 16:50647247-50647269 ATCATGTGTGACCTTATTCTGGG + Intergenic
1139557006 16:67718891-67718913 GTTATGTCTCAGGTTCTTCCAGG + Intronic
1139585066 16:67897348-67897370 GTCATCACTGAGCTAATTCTTGG + Intronic
1139877741 16:70159878-70159900 CTTGTGTCTCAGCTCATTCTGGG + Exonic
1144266613 17:13575538-13575560 TTCAGCTCACAGCTTATTCTAGG + Intronic
1146934973 17:36807783-36807805 GTCATCTCTCTGCCTATTCGGGG + Intergenic
1147641224 17:42001454-42001476 GTCATGTCTGATTTGATTCTAGG - Intronic
1152486852 17:80600176-80600198 GTCATGCCACAGCCTCTTCTGGG + Intronic
1157429644 18:47614155-47614177 GGAAGGTCTCAGCTTATGCTAGG - Intergenic
1159322244 18:66866924-66866946 GCCATGCCTGAGCTTACTCTAGG + Intergenic
1160557075 18:79732901-79732923 TTCATGTCTCAGGTGATTTTGGG - Intronic
1163498138 19:17658780-17658802 ACCATGTCTCAGCATCTTCTTGG - Intronic
1166633005 19:44424381-44424403 GTCATCTCTCTGCATAATCTGGG - Intronic
1167568730 19:50273363-50273385 GGCAAATCTCAGCTGATTCTGGG - Intronic
926582070 2:14641695-14641717 TTCAACTCTCAGCTTATACTTGG + Intronic
928183371 2:29086874-29086896 GTCATGTCTCAGCCTCCCCTTGG + Intergenic
929413872 2:41727533-41727555 GTCATGACTGTGCTTCTTCTAGG - Intergenic
930619225 2:53626827-53626849 TCCATGTCTCACCTTAATCTTGG - Intronic
931072670 2:58670632-58670654 CTCATTTCTCAACTTATTTTAGG - Intergenic
931619158 2:64192436-64192458 GTCAAGTTACAGCTTAATCTGGG - Intergenic
931866044 2:66412955-66412977 GTAAAGTCTCAGCTTATGGTTGG + Intergenic
933638098 2:84729043-84729065 ATCTTGTCTCGGCTTTTTCTGGG - Intronic
937870891 2:126785281-126785303 GTCATGTGTTAGCTTCTACTCGG + Intergenic
940004199 2:148996640-148996662 CTCCTGTCTCAGCATATGCTTGG - Intronic
948885204 2:240878805-240878827 GGCAGGTCACAGCTTCTTCTTGG - Exonic
1170534940 20:17331375-17331397 TTCATGACTCAGGTTCTTCTTGG - Intronic
1175009536 20:55721387-55721409 GTCATGTCTAAGTTGATTTTGGG - Intergenic
1180184729 21:46133854-46133876 GCCAGGGCTCAGCCTATTCTAGG + Intergenic
1182702409 22:32251205-32251227 GTCATATCCCAGGTTTTTCTGGG - Intronic
950592580 3:13949097-13949119 TTCATGTCTCAGCTTTTTATAGG - Intronic
950658479 3:14452078-14452100 GCCATCTCCCAGCTTCTTCTGGG + Intronic
951628030 3:24688055-24688077 GTTATGTCTGAGATTATTATGGG - Intergenic
953752536 3:45619885-45619907 TTCAGGTCTCAGCTTAATTTAGG - Intronic
955046608 3:55366992-55367014 ATCATGTCTCTTCTTATTCCTGG - Intergenic
955240287 3:57171884-57171906 GTCATGTCTCAGGTTCCTCTTGG + Intergenic
955527385 3:59835525-59835547 GTCATGAGTGAGCTTGTTCTAGG + Intronic
959594809 3:108118160-108118182 GGCATGACTCACCTTATTTTGGG - Intergenic
962098597 3:132317644-132317666 GTCAGGTTTCATCTTATCCTTGG + Intronic
963192200 3:142485049-142485071 CACATGTCTTAGCATATTCTAGG - Intronic
963692282 3:148519468-148519490 GTCATGTCTGAACTTATCCTGGG + Intergenic
964398577 3:156273682-156273704 GTCATCTCTCAGCTGATGTTTGG + Intronic
964817652 3:160733982-160734004 GTCATTTCTCAAGTTATTGTTGG + Intergenic
968535927 4:1129281-1129303 GTAATGTCTCTCTTTATTCTTGG - Intergenic
971539250 4:27795194-27795216 CCAATGTCTCAGCATATTCTAGG + Intergenic
972917462 4:43898501-43898523 GACATGTATCATATTATTCTGGG + Intergenic
974705108 4:65504669-65504691 GCCATGTGTCAGTTCATTCTAGG - Intronic
975297337 4:72749770-72749792 GACATGTCTCAGTTTTTTCTTGG + Intergenic
975596926 4:76056206-76056228 GTTATCTCTCTGCTCATTCTAGG + Intronic
976540083 4:86264384-86264406 ATCATGTCTCTTCTTGTTCTTGG - Intronic
984306229 4:177995512-177995534 CTCTTGTCTCAGCTTCTTTTTGG + Intergenic
987858921 5:23458499-23458521 CTCAGGTTTCAGCTTTTTCTAGG + Intergenic
988214738 5:28256713-28256735 CTCAACTCTCAGATTATTCTAGG - Intergenic
990489808 5:56293752-56293774 CTCAAGTATCATCTTATTCTAGG - Intergenic
992856716 5:80869259-80869281 TTCATGTTTCTGCTTATTATGGG - Intronic
993615673 5:90109014-90109036 GCCATATCTGAGCTTATTCAAGG + Intergenic
996653834 5:125915073-125915095 GACATGTCTCACCTGATTTTAGG + Intergenic
998799123 5:145850830-145850852 GTCATGTCTTAGCTCAATCCAGG + Intergenic
998909714 5:146945841-146945863 CACGTGTCTCAGCTCATTCTTGG - Intronic
1000760801 5:165222199-165222221 GCCATGTCTCTGATTATTATTGG - Intergenic
1003054659 6:2807189-2807211 GTCAGCTTGCAGCTTATTCTAGG - Intergenic
1003403283 6:5808582-5808604 GGCAAGCATCAGCTTATTCTGGG - Intergenic
1005173562 6:23016794-23016816 GTCAGGTGTCATTTTATTCTTGG + Intergenic
1009561254 6:65246928-65246950 TTCATTTCTGAGTTTATTCTAGG - Intronic
1009852271 6:69212545-69212567 GTCATGTTTCAGTTTCTACTGGG - Intronic
1011115664 6:83888612-83888634 TTCCTGTCTCACCTTCTTCTTGG + Intronic
1011875540 6:91956737-91956759 GTAATGACTCAGGTTATTTTAGG - Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1015859210 6:137657814-137657836 TTCAAGTCTTAGCTTATTCTGGG - Intergenic
1018117049 6:160597004-160597026 TTCATATCTCACTTTATTCTGGG + Intronic
1019448929 7:1086247-1086269 GACATGTCTCAGCTATTTCAAGG + Intronic
1022326956 7:29341129-29341151 GTCATCTTTCAGGTTCTTCTTGG + Intronic
1022997638 7:35774221-35774243 ATCATGTCTCAGATTCTTCTTGG - Intergenic
1023569074 7:41553773-41553795 CTGATGTCTCAGCTTTTTATAGG - Intergenic
1024160555 7:46670555-46670577 GTCATGTCTGAGCTGAGACTGGG + Intergenic
1028992105 7:97060161-97060183 GTCATGTCTCTGCTTGGTTTTGG - Intergenic
1029848197 7:103435337-103435359 TTCATATGTCAGGTTATTCTTGG + Intronic
1029949691 7:104570314-104570336 CTCATGTGTCAGCTTTTCCTTGG + Intronic
1032381412 7:131486675-131486697 CTCATGTCTCAGCTATTTCAGGG + Intronic
1033005223 7:137554273-137554295 TTCATGTCTCAGATTGGTCTAGG + Intronic
1037136165 8:15463832-15463854 GTGATGTTACAGCATATTCTGGG - Intronic
1039614756 8:38946477-38946499 GTCATGTTTCGGGTGATTCTGGG + Intronic
1039751462 8:40482552-40482574 GACTTGTCTCAGCTTTCTCTAGG - Intergenic
1040957024 8:52989890-52989912 GGCATATCTCTTCTTATTCTTGG - Intergenic
1041010458 8:53537452-53537474 TTCATGTATCAGCTGATACTGGG + Intergenic
1044693195 8:94898319-94898341 GTCATGTCTTAGGTTCCTCTTGG + Intronic
1045320095 8:101075841-101075863 GTCATGGCTCTGCTTGTTCTGGG - Intergenic
1050922834 9:11228080-11228102 GGCAAGTCTCAGTTAATTCTGGG + Intergenic
1051521911 9:17998840-17998862 GTCTCCTCTCAGATTATTCTAGG - Intergenic
1056026459 9:82502002-82502024 GTCTTATCTCAGCTAATTATAGG + Intergenic
1058578871 9:106433184-106433206 GTCATGTCTCAAATTATGGTGGG + Intergenic
1061484624 9:130914082-130914104 GCCAGGCCTGAGCTTATTCTCGG - Intronic
1203654973 Un_KI270752v1:14974-14996 GTGTTGTGTCAGCTCATTCTGGG + Intergenic
1186044551 X:5520700-5520722 GCCCTCTCTCATCTTATTCTAGG - Intergenic
1187779140 X:22797802-22797824 GACATCTCTCAGTTTATCCTTGG - Intergenic
1188350500 X:29124688-29124710 GCCATGTGTCACCTTTTTCTTGG + Intronic
1190502844 X:51096632-51096654 GTCGGGTCTCAGCTCATTCCTGG - Intergenic
1193681574 X:84525767-84525789 GACCTGTCTCAGATTATTTTGGG + Intergenic