ID: 1080787752

View in Genome Browser
Species Human (GRCh38)
Location 11:35491298-35491320
Sequence CAGTTTACAGAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080787752_1080787757 -6 Left 1080787752 11:35491298-35491320 CCATCCTCCCTCTCTGTAAACTG 0: 1
1: 1
2: 3
3: 36
4: 429
Right 1080787757 11:35491315-35491337 AAACTGGAAATATCATTCATAGG 0: 1
1: 0
2: 1
3: 30
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080787752 Original CRISPR CAGTTTACAGAGAGGGAGGA TGG (reversed) Intronic
901184495 1:7363995-7364017 CAGCTTACAGAGAGGGACTGAGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903133462 1:21293854-21293876 CAGCTTACAGAGAGGGGGAGGGG + Intronic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
904995397 1:34627643-34627665 CAGCTGACAGTGAGGGAGGGAGG + Intergenic
905324921 1:37145144-37145166 CATTTTACCCAGAGGAAGGAAGG + Intergenic
905341520 1:37281606-37281628 TATTTCACTGAGAGGGAGGAGGG + Intergenic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
907202637 1:52740881-52740903 CATTTTACAGACAAAGAGGAAGG - Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
908813918 1:68012226-68012248 AAGTTAACAGAGAGTGAGGGAGG - Intergenic
909694434 1:78450161-78450183 CATTTGACAGAGAAGGAAGATGG - Intronic
910246365 1:85142909-85142931 CAGCTCACGGAGAGGGAGCATGG + Intergenic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
910505219 1:87942851-87942873 CACTTTACAGAGAGGAAGTGAGG + Intergenic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911749691 1:101482080-101482102 AAGATTACAGGGAGGGAAGAAGG - Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912836366 1:112999990-113000012 CAGCTTCCAGGGAGGGAAGAGGG - Intergenic
912926812 1:113920318-113920340 GAGGTCACAGAGAGGGAGGCAGG + Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
917734802 1:177910577-177910599 GAGTACACCGAGAGGGAGGAAGG + Intergenic
918292547 1:183122739-183122761 GAGCTCACAGAGAAGGAGGAGGG + Intronic
918449849 1:184647619-184647641 CAGTTTATAGAGAAGGGTGAAGG - Intergenic
919117379 1:193297205-193297227 CAGTTTAAAGAGACTGAGCAAGG + Intergenic
919342147 1:196325276-196325298 CAGGTTACAGACAGGAAGGTAGG - Intronic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
921031375 1:211337811-211337833 CATTTCACTGAGATGGAGGAAGG + Intronic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
923588814 1:235300496-235300518 CTGTTTACAGATAGGGAAAATGG - Intronic
1063332333 10:5173347-5173369 CACTTCCCAGAGAGGGAGGATGG + Intergenic
1063956500 10:11272479-11272501 CAGTTTTCAGAAATGGTGGATGG - Intronic
1064565517 10:16635382-16635404 CAGCTAGCTGAGAGGGAGGATGG - Intronic
1065236527 10:23658064-23658086 CAGTTTCAAGAGAGGCATGAGGG + Intergenic
1065882203 10:30046516-30046538 CAGGTTACAGAGAGTGAAAAGGG - Intronic
1066402012 10:35085851-35085873 CTTTTTACAGCGAGGGAGGAAGG + Intronic
1066640018 10:37546560-37546582 CAGCTTACACAGAGGGCTGAAGG - Intergenic
1067703481 10:48590110-48590132 CACTTTACAGAGAGAGGGTAGGG + Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1071150619 10:82630084-82630106 CAGTTTCCAGCCAGGGAGTATGG + Intronic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071525494 10:86355684-86355706 CTGTTTACAGGCTGGGAGGAAGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1074140122 10:110664938-110664960 CAGGTTACAGTGAGGTATGATGG - Intronic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1080467492 11:32511407-32511429 AGGATTCCAGAGAGGGAGGAGGG + Intergenic
1080786063 11:35476235-35476257 GAGATTACAGAGAGAGATGATGG - Intronic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081396185 11:42588967-42588989 TATTTTACAGAGAAGGAGAAAGG + Intergenic
1081545722 11:44070276-44070298 CAGTACACAGAGAGAGGGGAGGG + Intronic
1082747795 11:56984954-56984976 CAGTTTACACAGGGAGAGGGAGG + Intergenic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1086951663 11:92897046-92897068 GAGGTTACAGACAGGGAGTAGGG + Intergenic
1087596983 11:100266646-100266668 CACTTTAAAGAGAGGAATGAAGG + Intronic
1088807085 11:113362427-113362449 CAATTTTCAGAGAGGAAGAAAGG - Exonic
1088839758 11:113615343-113615365 CAGTTTACAGACAGGAGGGAGGG + Intergenic
1089412948 11:118262535-118262557 CAGTTTCCAGAGAAGGATGGAGG + Exonic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091533538 12:1383919-1383941 CATTTTACAGAGAGGGAAAGAGG + Intronic
1091681729 12:2532365-2532387 CAGATGTCAGAGAGGAAGGAAGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092479552 12:8847711-8847733 CTGCTGACAGAGTGGGAGGAGGG + Intronic
1092896050 12:13011351-13011373 GAGTTTACTGAGAAGGAAGAAGG + Intergenic
1093019641 12:14191462-14191484 GAGTTTGGAGGGAGGGAGGAGGG + Intergenic
1093066185 12:14660930-14660952 CGGTATCCAGAGAGGCAGGAAGG - Intronic
1096011359 12:48218377-48218399 AAATTTTCAGAGCGGGAGGAGGG + Intergenic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1097271942 12:57780892-57780914 CTGTTCTCAGAGAAGGAGGATGG + Exonic
1097488120 12:60231800-60231822 CAGTATAGAGAAAGGAAGGAAGG - Intergenic
1098583455 12:72129441-72129463 CAATTTACAGAGTGTTAGGAAGG - Intronic
1101196234 12:102385661-102385683 GAGTTTTCAGAGAGAGAGCATGG - Intergenic
1101322598 12:103686272-103686294 CAGTTGACAGTGAGAGGGGAAGG - Intronic
1101849960 12:108393976-108393998 CATTTTACAGAAAGGGAAGTGGG - Intergenic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102666583 12:114579298-114579320 GAGGTTTCAGAGAGGGAGGCAGG - Intergenic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104820225 12:131672799-131672821 CACTTTACAGAGAGGAACGGAGG + Intergenic
1105825642 13:24120153-24120175 GAGTTTCCGGGGAGGGAGGAAGG - Intronic
1106181412 13:27372604-27372626 TTGTTTTCAGAGAGAGAGGAAGG - Intergenic
1107734999 13:43389913-43389935 CACTTGACAGAGGGGGAGAAGGG + Intronic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1107892930 13:44930196-44930218 CAGGTTAGAAAGTGGGAGGAGGG - Intergenic
1107920329 13:45200204-45200226 AAATTAACAGACAGGGAGGAGGG + Intronic
1108463689 13:50693532-50693554 CAGTTTACAGAGAGGGAGGGTGG - Intronic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1110260823 13:73483338-73483360 CAGGTCACAGAGAGGATGGAAGG - Intergenic
1112397607 13:99047581-99047603 GAGGTTACAGAGAGCCAGGATGG - Intronic
1112786338 13:102955624-102955646 TAGTTTTCAGAAAGGGAGGTGGG + Intergenic
1113519234 13:110927041-110927063 TAGTAAACAGAGAGGGAAGAGGG - Intergenic
1113736264 13:112680692-112680714 CAGTTTACAGACAGGCAAGCAGG + Intronic
1113758808 13:112833357-112833379 CAGTTTTCTGAGATGCAGGAGGG - Intronic
1116394488 14:44431078-44431100 CACTTCCCAGAGAGGGAGAATGG + Intergenic
1116557497 14:46330678-46330700 CATTTTACTGAGAGGAAAGATGG - Intergenic
1116779206 14:49217477-49217499 CAGTTCACAGAGAGGAAGCACGG + Intergenic
1117448362 14:55826811-55826833 GAGTTCACTGAGAGGCAGGAAGG - Intergenic
1117604684 14:57415797-57415819 CAGTTTGGAGGGAGGGAGGGAGG - Exonic
1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG + Exonic
1117705256 14:58460046-58460068 AAGTTTACAGAAAGAGAGAAAGG + Exonic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1120346805 14:83301022-83301044 TAGCTTATAGAGAGGGAGAATGG + Intergenic
1120901164 14:89576778-89576800 CAGTTGGGAGAGACGGAGGAGGG - Intronic
1121043957 14:90774537-90774559 CTGTTCACAGAGGGGGTGGAGGG - Intronic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121303461 14:92890124-92890146 CAGTTCACTGAGATGGAGGGAGG - Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1122729622 14:103786421-103786443 CAGTTCACAGAGAAGGAAAATGG - Intronic
1122856286 14:104561742-104561764 AAGTTTACGGAGTGGGAGGCAGG + Intronic
1123724354 15:23087309-23087331 CAGTTTGCAGAAAAGGAGGCAGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1129229709 15:74190346-74190368 CACTTTACAGATGGGGAGAATGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130577981 15:85109268-85109290 GAGTCCACAGAGAGGGAGAAAGG - Intronic
1130624143 15:85496128-85496150 CACTTTACAGCCAGGGTGGATGG + Intronic
1131364314 15:91825273-91825295 AAGTCTAGAGAGAGGAAGGATGG - Intergenic
1132242667 15:100270912-100270934 CAGATGGCTGAGAGGGAGGAGGG - Intronic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132988816 16:2782719-2782741 CAGATTACGGAGAGGGAAGTAGG + Intergenic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134673986 16:16076479-16076501 AAGGTCACAGAGAGGGAGCACGG - Intronic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1137289165 16:47039958-47039980 CATTTTACAGACAGGAAGCAAGG + Intergenic
1137586038 16:49664502-49664524 GATTCTACAGAGATGGAGGAGGG + Intronic
1137600076 16:49750444-49750466 CAGTTGGCAGAAAGAGAGGAAGG - Intronic
1137875921 16:51996708-51996730 TGGTTTAAAGAGGGGGAGGAGGG - Intergenic
1139108912 16:63864604-63864626 CTGTTCACAAAAAGGGAGGAAGG + Intergenic
1139524361 16:67504826-67504848 AAGTTTACTGAGAGAGAGAAGGG - Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140218038 16:73023924-73023946 CAGTCTACAGATAGGGTGGGAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1144443977 17:15309468-15309490 CTCTTTACAGAGAAAGAGGAGGG - Intronic
1144945079 17:18965681-18965703 CAGTACACAGGGAGGGAGCAAGG - Intronic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145838382 17:27972247-27972269 TAATTTACAGAGAAGGAAGAAGG + Intergenic
1145925864 17:28646070-28646092 CATTTTACAGAGAAGGAAGCAGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148580189 17:48738344-48738366 CAGGTTATTGAGAGGGTGGAGGG - Intergenic
1148633222 17:49128243-49128265 CACTTTCCAGAGAGGGAGAATGG + Intergenic
1149450964 17:56749777-56749799 CATTTTACAGATAGGGAAGCAGG - Intergenic
1149490093 17:57078367-57078389 CAGGTTTCAGAGAGGGAGCATGG - Intergenic
1150315000 17:64161484-64161506 CAGTTTCCAGAAAGAAAGGAAGG - Intronic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1150711171 17:67531980-67532002 GGGTTTTCAGAGAGGCAGGAAGG + Intronic
1153817024 18:8799336-8799358 GATTGTACAGAGAGGGAGCAGGG - Intronic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1155494013 18:26425282-26425304 CACTTTCAAGAAAGGGAGGAGGG - Intergenic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1156326610 18:36079429-36079451 CAGCTGACAGTGAGGGCGGATGG + Intergenic
1156570717 18:38249891-38249913 CAGTATACAGAGAGGCAGGGAGG + Intergenic
1156698454 18:39795769-39795791 CAGTTTGCAGAGGGAGAGGGAGG + Intergenic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1159284267 18:66328848-66328870 CAGTTCACATTGAGGCAGGATGG - Intergenic
1159442913 18:68504761-68504783 CTGTTGAGAGAGAGAGAGGAAGG + Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1166419492 19:42625521-42625543 AGCTTTACAGAGAGGGAAGAAGG - Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1168715636 19:58525553-58525575 CAGCTTAGAGAGAGGCTGGAGGG + Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926359594 2:12073620-12073642 CATTTTACAGAGAAGGAAGCAGG + Intergenic
926690859 2:15732446-15732468 CAGTTTCCAAAGAGGAAGGAAGG + Intronic
926931762 2:18048158-18048180 CAGTTCACAGAGAGATAGGTTGG - Intronic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927352491 2:22133754-22133776 CAAATGATAGAGAGGGAGGAGGG - Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928083934 2:28334013-28334035 TAGTTAACGGAGTGGGAGGAGGG - Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
931358811 2:61560210-61560232 CATTTTACAGATGGGGAGGCTGG - Intergenic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
933589699 2:84218591-84218613 CATGATACAGATAGGGAGGAAGG + Intergenic
933969455 2:87458351-87458373 CATTTTACAGTGAGGAAGGCGGG - Intergenic
934150952 2:89147098-89147120 CAATTTACAGACAGGCAGCAAGG + Intergenic
934216321 2:90034927-90034949 CAATTTACAGACAGGCAGCAAGG - Intergenic
935402138 2:102671146-102671168 GAGTTTACAGAGAAGGAAGCGGG + Intronic
935623667 2:105150502-105150524 CACTTTACAGATAAGGAAGAAGG + Intergenic
935676383 2:105598097-105598119 CAGTGCACAGAGTGGGAGGCAGG - Intergenic
936324331 2:111492143-111492165 CATTTTACAGTGAGGAAGGCGGG + Intergenic
936451942 2:112640442-112640464 GAGTTTTCAGGGAGGGAGTAGGG - Intergenic
936540113 2:113342825-113342847 CACATTACAAAGAGGAAGGACGG - Intergenic
937022077 2:118666388-118666410 AAATTTAGAGAGAGGCAGGAAGG + Intergenic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
938201761 2:129378034-129378056 GAGGTTACAGAGAGGATGGATGG + Intergenic
938611344 2:132950479-132950501 CAGTTTTCAGACACTGAGGATGG + Intronic
939055091 2:137355787-137355809 CACTTTACAGAGAAGGAAAAAGG - Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
942415699 2:175757024-175757046 CATTTTACAGAGAGGAAAGCAGG + Intergenic
942657899 2:178233340-178233362 CAGTTTTCAGAGAGCAAGGCTGG - Intronic
942941673 2:181626022-181626044 CATTTTACAGATTGTGAGGAAGG + Intronic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
945017849 2:205538329-205538351 GAGTTTACAGGGATGAAGGATGG + Intronic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945339510 2:208635079-208635101 GAATTTACAGTGAGGGATGAAGG - Intronic
945686563 2:212977859-212977881 CAAATTACAAAGAGGGAGGGAGG - Intergenic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946132711 2:217619663-217619685 CAGTTAGCAGGGTGGGAGGATGG + Intronic
946598285 2:221331015-221331037 CAGATTGGAGAGTGGGAGGAAGG + Intergenic
947662608 2:231880905-231880927 CAGATTCCAGAAAGGGAGGCGGG - Intergenic
948000024 2:234560158-234560180 CAGTTTGCAGAATGGGAGAAGGG + Intergenic
948255593 2:236566229-236566251 CAGATTACAGACAGGGAAGGAGG + Intergenic
948343936 2:237279481-237279503 CAGTTTATAGAGAGGCTAGAAGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169861204 20:10154482-10154504 CAATATACAGAAAGAGAGGAAGG + Intergenic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172361050 20:34312662-34312684 CAGTCCACAGAAAGGGAGCACGG + Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173339999 20:42144586-42144608 TATTTCACAGACAGGGAGGACGG + Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1174836927 20:53865061-53865083 CTGTGTACAGAGAGGGCCGATGG + Intergenic
1175778470 20:61667491-61667513 CTGTTTCCAGAGAGGGTGGCCGG + Intronic
1177567496 21:22843894-22843916 CAGGTTCCAGAGATGAAGGAGGG + Intergenic
1178699569 21:34821492-34821514 CGGTTTGCAGAGGGGGAGAAGGG + Intronic
1179270671 21:39848130-39848152 CAGTTTGCAAAGAGAGAGGGTGG + Intergenic
1179413137 21:41177549-41177571 AAGGTGACAGAGAGGTAGGAGGG - Intronic
1180196293 21:46196392-46196414 CAGTTTACACAGACCGATGAGGG + Intronic
1180577313 22:16790551-16790573 GAGGCTACAGAGTGGGAGGAAGG + Intronic
1180614523 22:17119194-17119216 CAGTTAACGGTGAGGGAGGTAGG - Exonic
1180947232 22:19702970-19702992 CAGATTGCAGACAGGGAGGCAGG + Intergenic
1181568329 22:23752772-23752794 CATTTTACAGAGGGGAAGCAAGG + Exonic
1181773490 22:25143522-25143544 CAATTTATAGAAAGGAAGGAAGG - Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184047476 22:41980501-41980523 CATTTTATAGAGAGGGATGCAGG + Intronic
1184114181 22:42412656-42412678 CGGTAGACAGAGAGGGAGGCAGG + Intronic
1184557854 22:45242699-45242721 CACTTTACAGACAGGGATGCAGG - Intergenic
1184573372 22:45341525-45341547 GAGTTTGCAGAGAGTGAGGGAGG + Exonic
949165325 3:933670-933692 GAGTTAAAGGAGAGGGAGGATGG + Intergenic
949341165 3:3032555-3032577 CACATTACAGAGGGGGAGGCAGG + Intronic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950077900 3:10200193-10200215 CATTTTACAGATGGGGAGGCCGG + Intronic
950794078 3:15496392-15496414 TAGTTGACTGGGAGGGAGGAGGG - Intronic
951923785 3:27885196-27885218 CAGTATACAGAAAGAGAGTATGG + Intergenic
952721863 3:36541981-36542003 TATGTTAGAGAGAGGGAGGAAGG + Intronic
952818496 3:37466011-37466033 CATTTTACAGATAGGGAAGCAGG - Intronic
952970345 3:38646832-38646854 CACTTGACAGAGAAGGAAGATGG + Intronic
954001951 3:47564808-47564830 TACTTTACGGAGAGGGAGGTGGG + Intronic
954122383 3:48507007-48507029 CTGTTTACAGAGCTGTAGGAAGG - Intergenic
954364099 3:50137276-50137298 CAGTTTCCAAAGAAGGAGGCTGG - Intergenic
954483495 3:50823804-50823826 CAATTTACTGGGAGGGAGGTGGG - Intronic
954831301 3:53423521-53423543 CATTGTACAGAGAGGGAAAAAGG - Intergenic
955205823 3:56895087-56895109 CAAATTACAGGGAGGGAGGGAGG - Intronic
957501862 3:81067549-81067571 CACTTTCCAGAGAAGGAGAATGG - Intergenic
958744328 3:98114227-98114249 CAGTTTACACAGGGAGAGGGAGG - Intergenic
960249841 3:115439637-115439659 CAGCCTACATAGTGGGAGGAGGG + Intergenic
960287168 3:115842662-115842684 CTGATTAGAGAGAGGCAGGAAGG + Intronic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
960653708 3:119979519-119979541 CACTTCCCAGAGAGGGAGAATGG - Intronic
960865002 3:122190516-122190538 CAGTTTACAGATAAGGAAAATGG - Intronic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
961595745 3:128014784-128014806 CAGTTTTCACAGAGAGAGAAAGG - Intergenic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
962405694 3:135097959-135097981 AAGTTGGCACAGAGGGAGGATGG - Intronic
964082154 3:152772647-152772669 AAGTTTACAGAAAAGGAGAATGG + Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965090197 3:164151609-164151631 CACATTACAGAGAGAGAGGAAGG - Intergenic
966328546 3:178784388-178784410 CAGTTTACAAAGAGGAAGCATGG - Intronic
966422676 3:179748870-179748892 CAGTTTACAGATAGGGAAGCTGG - Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
967274767 3:187763499-187763521 CAGGTTAAAGAGAGGAAGTATGG + Intergenic
967746284 3:193059575-193059597 CAGTTTAAAGACAGAGAGAAAGG - Intergenic
968091359 3:195900237-195900259 CAGCTCACCGAGAGAGAGGAGGG + Intronic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969418082 4:7074051-7074073 CAGTTTACTGACAGTGAGGTGGG - Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970702779 4:18762596-18762618 AAGTTTAGAGGAAGGGAGGAGGG + Intergenic
971372254 4:26028699-26028721 GATTTTACATAGAGAGAGGATGG + Intergenic
971628362 4:28954808-28954830 CAGTGGACAGAGAGTGTGGAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973083255 4:46022172-46022194 CATTTTCCAGAGATGGAAGAAGG - Intergenic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
974635462 4:64558777-64558799 ATATTTACAGGGAGGGAGGAAGG - Intergenic
976124186 4:81816049-81816071 AAGTTCACAGAGAGAGAGCAGGG + Intronic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
978111317 4:104967174-104967196 ATATTTACAGAGTGGGAGGAGGG + Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
980809479 4:137856772-137856794 AAGTATACAGAGAGAGTGGAAGG + Intergenic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
984725266 4:183013999-183014021 CAGTGCACTGAGACGGAGGATGG - Intergenic
986630375 5:9766809-9766831 AAGCATACAGAGAGGGAGGGAGG + Intergenic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
991503691 5:67302961-67302983 CACTGGACAGAGAGGGAGAAGGG + Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992847289 5:80763749-80763771 AAGTTTACAAAAAGGCAGGAAGG - Intronic
993518159 5:88863651-88863673 CAGTTTCCAGAAATGGAGGCGGG - Intronic
993637331 5:90360385-90360407 TAGTAGACAGAGAGAGAGGAGGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994449368 5:99922130-99922152 TAGTTTACATTGAGGGAGGAGGG + Intergenic
994513513 5:100739835-100739857 GAGTTTAGAGAGAGGTAGGGAGG - Intergenic
994900736 5:105765330-105765352 CAGATTACAGGGAGAGAGGTGGG + Intergenic
995547436 5:113247128-113247150 TAGTTTACACATATGGAGGAAGG + Intronic
995695341 5:114872927-114872949 CCATTTACTGAGAGGGAGAAAGG - Intergenic
996370271 5:122745927-122745949 GATTTTACAAAGATGGAGGAAGG + Intergenic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
997340906 5:133143858-133143880 CAGTCTACAGAGAGGTAGGGAGG - Intergenic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
999828968 5:155300991-155301013 AAGTGTACAGGGTGGGAGGAGGG - Intergenic
1000128847 5:158275080-158275102 CAGTTGACAGATAAGGAGAATGG + Intergenic
1001057866 5:168464352-168464374 CAGTGTACAGAGAGGGCGGGTGG + Intronic
1001181371 5:169523706-169523728 CATTTTACAGAGAGGAAGAATGG + Intergenic
1001675284 5:173507259-173507281 CAGTACCCAGAGAGGGAGGCTGG + Intergenic
1001957202 5:175856169-175856191 CATTTTACAGAGAAGGAGAGAGG - Intronic
1002626635 5:180534153-180534175 CAGGTTACAGAGAGAAATGAGGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1004442177 6:15663849-15663871 GAATTGACGGAGAGGGAGGAAGG - Intergenic
1004507273 6:16257105-16257127 CATTTTCCAGAGAGGGGAGAGGG + Intronic
1005015883 6:21375208-21375230 CAGTTTACACGGAGTGTGGAAGG - Intergenic
1006388949 6:33747513-33747535 GACTTTGCAGAGAGTGAGGAGGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1008193305 6:48486806-48486828 CAGTTTCCAAGGATGGAGGAGGG + Intergenic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1013435282 6:110098842-110098864 CAGGTTTGAGAGAGGGAGGTAGG + Intergenic
1013569446 6:111407043-111407065 CAGGTTACAGTGAGGTATGATGG + Intronic
1017792573 6:157814391-157814413 CAGTTTTCAAGGAGGAAGGATGG - Intronic
1018103443 6:160461774-160461796 AAGTTTACAGAAAGGCATGAAGG + Intergenic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1020612585 7:10418955-10418977 GAGTTTACAGTGAGTCAGGAGGG + Intergenic
1020811840 7:12857709-12857731 CAGTTTTCAGAGAAGGGAGATGG + Intergenic
1021179454 7:17488897-17488919 TAGCTAACAGAGAGAGAGGAGGG - Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1022253703 7:28634189-28634211 CTGTTTACAGACAGGCTGGATGG - Intronic
1022532018 7:31072920-31072942 CTGGTTTCAAAGAGGGAGGAAGG + Intronic
1022860525 7:34362294-34362316 CACTCTACAGAGATGGAGGGTGG - Intergenic
1023480072 7:40624739-40624761 CGTTTTACAGAGACAGAGGAGGG - Intronic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023725343 7:43137405-43137427 CATTTTAGAGAGAGGCAGGAAGG - Intronic
1024447979 7:49503870-49503892 CTGCTCACAGAGAGGAAGGAAGG - Intergenic
1024688945 7:51778873-51778895 CAGTTTACAGAGCAGTAAGAAGG + Intergenic
1026013648 7:66655291-66655313 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026025652 7:66741452-66741474 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026591724 7:71702128-71702150 GAGTAGAGAGAGAGGGAGGAGGG + Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1030192423 7:106822814-106822836 CAGTTTACAGAGAGGTGTGTAGG - Intergenic
1030591063 7:111482483-111482505 CAGTTTATAGAGAGCTAGAAAGG - Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1032364125 7:131283396-131283418 CAGTAAAGAGAGAGAGAGGAAGG - Intronic
1032743949 7:134767025-134767047 ATGTTTACAGACAGAGAGGAGGG + Intronic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033471267 7:141651680-141651702 CAGCTAACAGAGAGGAAGGATGG - Intronic
1033866138 7:145692373-145692395 CAGTTTACACAGGGAGAGGGAGG - Intergenic
1034257574 7:149733076-149733098 CAGCTTCCAGAAAGGAAGGAAGG - Intronic
1034717516 7:153256999-153257021 CATTTTACAGAGAAGGAGAGTGG + Intergenic
1035585060 8:766387-766409 CAGCTCACATAGAGGAAGGATGG - Intergenic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1036007270 8:4680493-4680515 TAAATTATAGAGAGGGAGGAAGG + Intronic
1036445324 8:8817156-8817178 CAGTTTAGATGGAGAGAGGATGG - Intronic
1036760858 8:11507724-11507746 CAGATGACAGTGAGGCAGGATGG + Intronic
1037173528 8:15921565-15921587 GAGTTTACACAGAGTGAGGGTGG + Intergenic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037734396 8:21555108-21555130 CAGCTTACAGAGGAGAAGGAGGG + Intergenic
1037763666 8:21758457-21758479 CAGTTTCCTGGGAGGCAGGAAGG - Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1040374091 8:46806287-46806309 CAGTTTACATAGGGAGAGGGAGG + Intergenic
1040655960 8:49508035-49508057 GGGGCTACAGAGAGGGAGGAAGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1042352319 8:67789809-67789831 CACTTTTCTGGGAGGGAGGAGGG + Intergenic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043075256 8:75690744-75690766 GAGAGTACAGAGATGGAGGAGGG - Intergenic
1043438239 8:80254645-80254667 CATTTTACAGAGAGGCAGCAAGG + Intergenic
1043504649 8:80890318-80890340 CAGGTTACTGAGAGGTGGGATGG - Intergenic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044418618 8:91965410-91965432 TAGTTGACAGTGAGGGAGGGAGG + Intronic
1044850228 8:96420121-96420143 CAGGTTACAGACAGGGATGGAGG + Intergenic
1045948842 8:107829074-107829096 GAGCTTGCAGTGAGGGAGGAAGG + Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1049851859 8:144836848-144836870 CAGTCTGCAGCGAGGGAGGCAGG + Intronic
1051388225 9:16534442-16534464 CAGTTTAGAGAGACGGATTAAGG - Intronic
1051487861 9:17627703-17627725 CAGTTATCACAGAGGGATGAAGG - Intronic
1051543515 9:18248277-18248299 CCGTTTTCAGAAAGGAAGGATGG - Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1051837908 9:21361781-21361803 CAGAGTACAGCGAGGGATGAGGG - Intergenic
1053070726 9:35100282-35100304 CAGGTTTGAGAGAGGGAGAAAGG - Intronic
1053361279 9:37488390-37488412 CACTGTACAGAGGGGGAGGCTGG - Intronic
1056127391 9:83549088-83549110 CAGGTTACAAGGAGGGAGAAGGG - Intergenic
1056431884 9:86535860-86535882 CACTTTAGAAAGAGGGAGTAAGG + Intergenic
1057233765 9:93342508-93342530 CAGTGTCCAGAGAGGCAGGGTGG + Intronic
1057252080 9:93511515-93511537 CAGTGTCCAGAGAGGCAGGGTGG - Intronic
1057746472 9:97756033-97756055 CATTTTACAGATAGGGAAGCTGG - Intergenic
1058504509 9:105654522-105654544 CATTTTACAGATAGGGACTAAGG + Intergenic
1058981011 9:110170690-110170712 CATTTTATAGTGAGGGAGGTTGG + Exonic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059925420 9:119204671-119204693 CAGTTAAAAGGAAGGGAGGAAGG - Intronic
1060005935 9:119999425-119999447 CAGTTTACAAAAAGGAATGAGGG + Intergenic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1060675425 9:125510121-125510143 CAGTTTACAGATTGGGATGCTGG + Intronic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061666337 9:132162737-132162759 CAGTTTGCAGAGAGATGGGAGGG - Intronic
1061799114 9:133104487-133104509 CACTTTCCAGAGGGGGAGGCAGG - Intronic
1062038206 9:134392114-134392136 CATTTTGCAGAGGGGGAGGGTGG + Intronic
1186014314 X:5173921-5173943 TATTTAACACAGAGGGAGGAAGG + Intergenic
1186179903 X:6963291-6963313 CAGCTAACAGAAAGGGAGGCTGG + Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1186735272 X:12456524-12456546 CCTTTGACAGAGAGGGAGGGAGG - Intronic
1186920682 X:14276090-14276112 AGGTTTGCAGAGAGGAAGGATGG - Intergenic
1187235414 X:17462817-17462839 CAATTTACAGACATGGGGGAGGG + Intronic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1189561201 X:42193031-42193053 CATATAAGAGAGAGGGAGGACGG + Intergenic
1189667348 X:43370945-43370967 TAGTTAACAGAGAGTGGGGAGGG + Intergenic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1190855899 X:54294643-54294665 CAGTTTGCTGAGCGGGAGCAAGG + Exonic
1192384585 X:70654021-70654043 TAGTTCAGTGAGAGGGAGGAAGG + Intronic
1192864662 X:75117905-75117927 CAGTTCACACAGAGAGAGAAAGG - Intronic
1194912860 X:99668395-99668417 CATTTTACAGAGAGAGAGAGAGG - Intergenic
1195356487 X:104044254-104044276 CATTTTCGAGACAGGGAGGAAGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1197603622 X:128559921-128559943 GAGTTTCCAGAGTGGGAGAAGGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197824793 X:130577387-130577409 CAGGTTAGAGAAAGGAAGGAAGG + Intergenic
1198029559 X:132741879-132741901 CCTTTTACAGATAGAGAGGAGGG - Intronic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1198931962 X:141871786-141871808 CACTTCCCAGAGAGGGAGAATGG + Intronic
1199113961 X:143968089-143968111 CATTTTACAGATGGGGAAGATGG + Intergenic
1199201885 X:145100404-145100426 CATTTGACAGAGAGAGAGGGAGG - Intergenic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1200822829 Y:7605740-7605762 CACTTTCCAGAAAGGGAGAATGG + Intergenic
1201738198 Y:17293935-17293957 CAGTTCAGAGAGAGGAAGGTAGG - Intergenic
1202189890 Y:22230996-22231018 CACTTCCCAGAGAGGGAGAATGG + Intergenic
1202237226 Y:22725349-22725371 CACTTTCCAGAGAGGGAGAATGG - Intergenic
1202304258 Y:23451580-23451602 GAGTATACAGAGGAGGAGGATGG + Intergenic
1202566552 Y:26219011-26219033 GAGTATACAGAGGAGGAGGATGG - Intergenic